Incidental Mutation 'R0827:Adamts15'
ID78323
Institutional Source Beutler Lab
Gene Symbol Adamts15
Ensembl Gene ENSMUSG00000033453
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 15
Synonyms
MMRRC Submission 039007-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0827 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location30899155-30922452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30921480 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 253 (Y253C)
Ref Sequence ENSEMBL: ENSMUSP00000067022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065112] [ENSMUST00000216215]
Predicted Effect probably damaging
Transcript: ENSMUST00000065112
AA Change: Y253C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067022
Gene: ENSMUSG00000033453
AA Change: Y253C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Pep_M12B_propep 24 157 8.7e-27 PFAM
Pfam:Reprolysin_4 216 422 8.2e-7 PFAM
Pfam:Reprolysin_5 217 404 7.2e-13 PFAM
Pfam:Reprolysin 218 427 3.7e-20 PFAM
Pfam:Reprolysin_3 240 372 6.1e-10 PFAM
Blast:ACR 429 507 1e-25 BLAST
TSP1 519 571 7.85e-12 SMART
Pfam:ADAM_spacer1 683 801 7.1e-36 PFAM
TSP1 842 895 3e-8 SMART
TSP1 896 949 4.21e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216215
Meta Mutation Damage Score 0.9607 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.6%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active versicanase enzyme. This gene is located adjacent to a related ADAMTS gene (Adamts8) on chromosome 9. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T C 7: 79,099,671 S1397P probably benign Het
Ankk1 A G 9: 49,421,737 I149T possibly damaging Het
Ankrd63 A G 2: 118,702,553 S296P possibly damaging Het
Arpc1b T G 5: 145,125,756 C227G probably benign Het
B4gat1 A G 19: 5,039,697 R241G possibly damaging Het
Ccar2 T C 14: 70,139,838 N751D probably benign Het
Cd55b T C 1: 130,414,236 I221M probably damaging Het
Cntn5 A G 9: 9,666,938 V1032A possibly damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Colec10 G A 15: 54,462,584 C270Y probably damaging Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cyp2j12 T G 4: 96,112,862 probably benign Het
Dennd5a G A 7: 109,899,731 T999M probably damaging Het
Dusp13 C A 14: 21,742,771 V29L probably benign Het
Efr3a A C 15: 65,853,551 D83A possibly damaging Het
Elmod2 A G 8: 83,316,795 probably null Het
Eml3 C A 19: 8,938,466 T640K probably damaging Het
Eps8l1 T C 7: 4,477,389 V543A possibly damaging Het
Ermn T C 2: 58,048,251 K117E probably damaging Het
F830045P16Rik A G 2: 129,472,776 S194P probably benign Het
Faim2 A G 15: 99,524,736 V60A probably benign Het
Fancd2 G A 6: 113,586,249 probably null Het
Fbxo43 A T 15: 36,162,969 S31T possibly damaging Het
Gab2 G A 7: 97,300,332 R411Q probably damaging Het
Gm17727 A T 9: 35,777,851 L12Q probably damaging Het
Gpm6a A T 8: 55,058,883 D264V probably damaging Het
Hist1h1t A G 13: 23,696,221 D119G probably benign Het
Hsp90aa1 T C 12: 110,692,695 E556G probably benign Het
Ifi203 A T 1: 173,928,463 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kcnc3 A G 7: 44,595,206 T307A probably damaging Het
Kin C A 2: 10,090,376 probably benign Het
Knl1 T C 2: 119,088,901 probably benign Het
Lrp4 G A 2: 91,495,041 V1404M probably damaging Het
Lrrc71 T A 3: 87,742,645 probably null Het
Med13l T C 5: 118,726,247 probably benign Het
Mfap5 A G 6: 122,520,920 D39G probably damaging Het
Mlxipl T C 5: 135,132,738 S504P probably benign Het
Myo3a T G 2: 22,558,215 Y1D probably damaging Het
Nek1 A G 8: 61,105,648 probably benign Het
Nfkbiz T C 16: 55,816,367 R524G probably damaging Het
Npbwr1 T C 1: 5,916,789 T169A possibly damaging Het
Nuggc T C 14: 65,608,891 Y84H probably damaging Het
Nxph3 G A 11: 95,511,426 S54L probably benign Het
Olfr311 T C 11: 58,841,771 I219T probably damaging Het
Olfr532 A G 7: 140,419,467 F102S probably damaging Het
Ostn A G 16: 27,324,631 N70D probably damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pnpla6 A T 8: 3,517,618 M109L possibly damaging Het
Ppil6 T A 10: 41,494,504 probably benign Het
Prss46 A G 9: 110,851,432 N215S probably benign Het
Ptprd A T 4: 76,128,915 D371E probably damaging Het
Ripor2 T A 13: 24,694,186 F315I probably damaging Het
Rmi2 G A 16: 10,835,240 G51S probably damaging Het
Scg3 A G 9: 75,683,697 I10T possibly damaging Het
Scn9a T A 2: 66,536,124 K761* probably null Het
Scyl2 A G 10: 89,657,865 L347P possibly damaging Het
Sh3d21 A G 4: 126,152,271 probably benign Het
Shc1 T A 3: 89,426,783 probably null Het
Slbp A G 5: 33,643,822 S182P probably damaging Het
Slc24a1 C T 9: 64,928,190 G885D probably benign Het
Slc24a3 T C 2: 145,518,492 probably benign Het
Sowahb T G 5: 93,043,286 N525H probably damaging Het
Sppl3 T A 5: 115,082,333 C101* probably null Het
Srsf5 A G 12: 80,949,540 K163E probably damaging Het
Sult2a4 A G 7: 13,984,961 I119T probably benign Het
Svep1 A G 4: 58,053,113 probably benign Het
Tas1r3 G A 4: 155,860,869 R632W probably benign Het
Tlr4 T A 4: 66,833,880 probably null Het
Tmf1 A C 6: 97,158,050 L1001* probably null Het
Tnnt2 A G 1: 135,843,796 probably benign Het
Trank1 G A 9: 111,349,417 probably benign Het
Trdn A T 10: 33,399,158 probably benign Het
Trmt6 A T 2: 132,815,834 V34E probably damaging Het
Trrap T C 5: 144,814,830 F1699L probably benign Het
Ttk A G 9: 83,843,915 R250G probably benign Het
Ttn T A 2: 76,809,904 I13787F probably damaging Het
Uggt1 T A 1: 36,156,313 probably null Het
Ugt2b35 T A 5: 87,008,130 probably benign Het
Ugt2b36 C A 5: 87,066,375 R470L possibly damaging Het
Unk A G 11: 116,053,109 D352G possibly damaging Het
Vmn2r77 G T 7: 86,802,016 C370F probably damaging Het
Vmn2r85 A G 10: 130,429,518 I32T possibly damaging Het
Zfp637 A G 6: 117,845,444 I178V possibly damaging Het
Zfp943 A G 17: 21,992,090 probably null Het
Zyg11a A G 4: 108,210,042 probably benign Het
Other mutations in Adamts15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Adamts15 APN 9 30902053 missense probably damaging 1.00
IGL01325:Adamts15 APN 9 30921688 missense possibly damaging 0.86
IGL01506:Adamts15 APN 9 30922134 missense probably benign 0.08
IGL01897:Adamts15 APN 9 30902152 missense probably damaging 1.00
IGL02137:Adamts15 APN 9 30910660 missense probably damaging 1.00
IGL02876:Adamts15 APN 9 30904522 missense probably damaging 0.98
IGL02997:Adamts15 APN 9 30906057 splice site probably benign
IGL03094:Adamts15 APN 9 30904472 splice site probably benign
IGL03146:Adamts15 APN 9 30921567 missense probably damaging 0.99
IGL03241:Adamts15 APN 9 30904485 missense probably damaging 1.00
Pugsley UTSW 9 30906158 missense probably damaging 1.00
R0118:Adamts15 UTSW 9 30911744 missense probably damaging 1.00
R0635:Adamts15 UTSW 9 30904770 missense probably damaging 1.00
R0946:Adamts15 UTSW 9 30902197 missense probably damaging 1.00
R1608:Adamts15 UTSW 9 30902479 missense probably damaging 0.99
R1806:Adamts15 UTSW 9 30904815 missense probably damaging 1.00
R1954:Adamts15 UTSW 9 30910708 missense probably benign
R1967:Adamts15 UTSW 9 30921309 nonsense probably null
R2009:Adamts15 UTSW 9 30922137 missense probably benign 0.17
R2129:Adamts15 UTSW 9 30904503 missense probably benign 0.05
R2329:Adamts15 UTSW 9 30902485 missense probably damaging 1.00
R2991:Adamts15 UTSW 9 30921394 missense probably benign
R3970:Adamts15 UTSW 9 30910602 missense probably benign 0.40
R4212:Adamts15 UTSW 9 30906174 missense probably damaging 0.99
R4326:Adamts15 UTSW 9 30904518 missense probably benign
R4329:Adamts15 UTSW 9 30904518 missense probably benign
R4594:Adamts15 UTSW 9 30921447 missense probably damaging 0.99
R5110:Adamts15 UTSW 9 30921444 missense probably benign 0.01
R5120:Adamts15 UTSW 9 30921576 missense probably damaging 1.00
R5697:Adamts15 UTSW 9 30911794 missense probably damaging 1.00
R5901:Adamts15 UTSW 9 30902490 missense probably damaging 1.00
R6011:Adamts15 UTSW 9 30902786 missense probably damaging 0.98
R6020:Adamts15 UTSW 9 30902062 missense probably benign 0.03
R6651:Adamts15 UTSW 9 30922152 missense probably damaging 0.98
R6665:Adamts15 UTSW 9 30904479 critical splice donor site probably null
R7021:Adamts15 UTSW 9 30921480 missense probably damaging 1.00
R7231:Adamts15 UTSW 9 30906158 missense probably damaging 1.00
R7290:Adamts15 UTSW 9 30902610 missense probably benign 0.05
R7390:Adamts15 UTSW 9 30911108 critical splice donor site probably null
R7798:Adamts15 UTSW 9 30904643 missense probably damaging 1.00
R7833:Adamts15 UTSW 9 30922105 missense probably benign
R7908:Adamts15 UTSW 9 30902226 missense probably benign
R8175:Adamts15 UTSW 9 30904656 missense probably damaging 1.00
R8177:Adamts15 UTSW 9 30922026 missense probably damaging 1.00
R8347:Adamts15 UTSW 9 30902550 missense probably benign 0.07
R8374:Adamts15 UTSW 9 30902706 missense probably benign 0.21
X0063:Adamts15 UTSW 9 30922230 missense possibly damaging 0.96
X0067:Adamts15 UTSW 9 30921582 missense probably damaging 1.00
Z1176:Adamts15 UTSW 9 30910700 missense probably damaging 1.00
Z1177:Adamts15 UTSW 9 30902491 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACTCAGGGTGCTTATCGCTCAC -3'
(R):5'- GTATGTCATTAGCCCTCTGCCCAAC -3'

Sequencing Primer
(F):5'- GTGCTTATCGCTCACTTTGTTCAG -3'
(R):5'- TTATAAGCCACGGCGGAC -3'
Posted On2013-10-16