Incidental Mutation 'R5561:Tm9sf1'
ID436625
Institutional Source Beutler Lab
Gene Symbol Tm9sf1
Ensembl Gene ENSMUSG00000002320
Gene Nametransmembrane 9 superfamily member 1
Synonyms1200014D02Rik, MP70
MMRRC Submission 043118-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R5561 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location55635965-55643806 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 55638097 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 397 (V397M)
Ref Sequence ENSEMBL: ENSMUSP00000118427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002391] [ENSMUST00000047131] [ENSMUST00000120041] [ENSMUST00000121791] [ENSMUST00000121937] [ENSMUST00000122358] [ENSMUST00000125133] [ENSMUST00000132338] [ENSMUST00000133707] [ENSMUST00000135221] [ENSMUST00000138085] [ENSMUST00000148351] [ENSMUST00000149726]
Predicted Effect probably damaging
Transcript: ENSMUST00000002391
AA Change: V397M

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002391
Gene: ENSMUSG00000002320
AA Change: V397M

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 564 1.3e-187 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047131
SMART Domains Protein: ENSMUSP00000036555
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 4e-20 BLAST
Blast:IBN_N 224 293 4e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.7e-7 PFAM
Blast:ARM 465 499 8e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
low complexity region 811 830 N/A INTRINSIC
low complexity region 851 864 N/A INTRINSIC
Pfam:HEAT 901 931 1.9e-5 PFAM
Pfam:HEAT_EZ 914 969 2.3e-9 PFAM
low complexity region 1043 1053 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120041
AA Change: V397M

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112893
Gene: ENSMUSG00000002320
AA Change: V397M

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 564 1.3e-187 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121791
AA Change: V397M

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112764
Gene: ENSMUSG00000002320
AA Change: V397M

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 564 1.3e-187 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121937
AA Change: V397M

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113143
Gene: ENSMUSG00000002320
AA Change: V397M

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 547 9e-169 PFAM
transmembrane domain 550 572 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122358
AA Change: V397M

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113782
Gene: ENSMUSG00000002320
AA Change: V397M

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 58 563 2.3e-164 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130167
Predicted Effect probably damaging
Transcript: ENSMUST00000132338
AA Change: V397M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118427
Gene: ENSMUSG00000002320
AA Change: V397M

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 477 9.2e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133707
SMART Domains Protein: ENSMUSP00000123471
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 118 1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135221
SMART Domains Protein: ENSMUSP00000123692
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 3e-20 BLAST
Blast:IBN_N 224 293 2e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.4e-7 PFAM
Blast:ARM 465 499 7e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138085
SMART Domains Protein: ENSMUSP00000119435
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 172 2.9e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146588
Predicted Effect probably benign
Transcript: ENSMUST00000156420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150951
Predicted Effect probably benign
Transcript: ENSMUST00000148351
SMART Domains Protein: ENSMUSP00000117543
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149726
SMART Domains Protein: ENSMUSP00000115403
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 390 1.7e-103 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik C A 14: 95,882,371 A188E probably benign Het
A630095N17Rik T C 1: 75,220,537 probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrv1 A G 13: 81,476,564 L3762P probably damaging Het
Amn1 G A 6: 149,185,024 R4W probably damaging Het
Atxn1 G T 13: 45,566,871 T516N possibly damaging Het
Atxn7 A T 14: 14,089,260 T259S probably benign Het
Bsn C G 9: 108,105,511 R3681P unknown Het
C8b T C 4: 104,784,448 Y194H possibly damaging Het
Ccdc110 T G 8: 45,940,609 S119R probably benign Het
Ceacam20 A T 7: 19,970,393 Q123L possibly damaging Het
Clip3 A G 7: 30,298,849 D240G possibly damaging Het
Col24a1 T C 3: 145,298,827 F22S probably benign Het
Dlg5 T A 14: 24,177,792 M354L probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dnase1l3 A G 14: 7,967,847 V282A probably damaging Het
Dnhd1 G A 7: 105,714,821 G4127S probably damaging Het
Eed G A 7: 89,967,793 R165W probably damaging Het
Ephb2 C T 4: 136,661,406 V627M probably damaging Het
Fancc T C 13: 63,317,387 E502G possibly damaging Het
Fbf1 T C 11: 116,157,820 D105G probably damaging Het
Fer T A 17: 64,037,585 Y246* probably null Het
Fer1l6 A G 15: 58,660,825 K1792E probably damaging Het
Foxi2 A G 7: 135,411,647 D202G probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
H2-DMb2 G T 17: 34,145,471 probably null Het
Helq G T 5: 100,787,050 D491E probably benign Het
Hgsnat A G 8: 25,946,334 V564A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hs3st5 T A 10: 36,833,429 V320D probably damaging Het
Ifit1bl1 A T 19: 34,593,797 L420* probably null Het
Ift80 T G 3: 68,967,863 N178T probably benign Het
Ing4 C T 6: 125,047,060 T89I possibly damaging Het
Lcp1 G A 14: 75,212,508 D386N probably benign Het
Mdc1 T A 17: 35,848,546 I606K probably benign Het
Mllt10 T A 2: 18,109,845 M120K probably damaging Het
Morc1 G T 16: 48,449,348 L89F probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nav3 C A 10: 109,716,552 D1810Y probably damaging Het
Obscn G A 11: 59,036,093 T5532M probably damaging Het
Olfr527 C T 7: 140,336,152 Q97* probably null Het
Olfr716 A G 7: 107,148,090 N258S probably benign Het
Opn3 C T 1: 175,665,587 R137H probably damaging Het
Palld G A 8: 61,516,585 A993V probably damaging Het
Ppp1r12c A T 7: 4,486,356 probably null Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Rapgef2 A T 3: 79,088,643 probably null Het
Ring1 T C 17: 34,021,458 E382G possibly damaging Het
Rpl22l1 T A 3: 28,806,820 N61K probably benign Het
Rpp14 A G 14: 8,090,558 probably null Het
Rusc2 C T 4: 43,415,932 Q413* probably null Het
Slco3a1 A G 7: 74,318,499 I491T possibly damaging Het
Smtnl1 C T 2: 84,818,395 V172I probably benign Het
Spats2l T A 1: 57,900,621 probably null Het
Spire1 T A 18: 67,506,646 N266Y probably damaging Het
Stox2 T C 8: 47,193,006 H473R probably damaging Het
Syne2 C T 12: 76,094,458 R121* probably null Het
Synrg G A 11: 84,002,240 probably null Het
Trabd T C 15: 89,081,984 M48T probably benign Het
Ttn T A 2: 76,707,233 I26457F possibly damaging Het
Uggt2 C T 14: 119,041,527 R856Q probably benign Het
Ugt1a5 T A 1: 88,166,317 M89K probably benign Het
Vmn2r53 A T 7: 12,601,420 S104R probably damaging Het
Zdhhc12 A T 2: 30,092,484 L53Q probably null Het
Other mutations in Tm9sf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Tm9sf1 APN 14 55642727 missense probably damaging 1.00
IGL01102:Tm9sf1 APN 14 55642767 missense probably damaging 1.00
IGL02263:Tm9sf1 APN 14 55642935 missense possibly damaging 0.95
R0242:Tm9sf1 UTSW 14 55637935 missense possibly damaging 0.90
R0242:Tm9sf1 UTSW 14 55637935 missense possibly damaging 0.90
R0469:Tm9sf1 UTSW 14 55641429 missense possibly damaging 0.87
R0928:Tm9sf1 UTSW 14 55636457 missense probably damaging 1.00
R0973:Tm9sf1 UTSW 14 55642935 missense possibly damaging 0.95
R0973:Tm9sf1 UTSW 14 55642935 missense possibly damaging 0.95
R0974:Tm9sf1 UTSW 14 55642935 missense possibly damaging 0.95
R1441:Tm9sf1 UTSW 14 55636325 missense probably damaging 1.00
R1644:Tm9sf1 UTSW 14 55641300 missense probably benign 0.03
R1873:Tm9sf1 UTSW 14 55636223 missense probably damaging 1.00
R2176:Tm9sf1 UTSW 14 55641409 missense possibly damaging 0.89
R2973:Tm9sf1 UTSW 14 55641114 missense probably benign 0.01
R4284:Tm9sf1 UTSW 14 55641323 missense probably damaging 1.00
R4545:Tm9sf1 UTSW 14 55638108 missense possibly damaging 0.74
R4633:Tm9sf1 UTSW 14 55641203 missense probably damaging 1.00
R4816:Tm9sf1 UTSW 14 55641149 missense possibly damaging 0.89
R4943:Tm9sf1 UTSW 14 55641168 missense probably damaging 0.99
R5270:Tm9sf1 UTSW 14 55636481 missense probably damaging 1.00
R5384:Tm9sf1 UTSW 14 55642844 missense possibly damaging 0.80
R5385:Tm9sf1 UTSW 14 55642844 missense possibly damaging 0.80
R5386:Tm9sf1 UTSW 14 55642844 missense possibly damaging 0.80
R6246:Tm9sf1 UTSW 14 55636370 missense probably damaging 1.00
R6247:Tm9sf1 UTSW 14 55636370 missense probably damaging 1.00
R6248:Tm9sf1 UTSW 14 55636370 missense probably damaging 1.00
R7319:Tm9sf1 UTSW 14 55637975 unclassified probably benign
R7659:Tm9sf1 UTSW 14 55636335 missense probably damaging 1.00
R7974:Tm9sf1 UTSW 14 55636449 missense probably damaging 1.00
X0025:Tm9sf1 UTSW 14 55642836 missense probably benign 0.43
X0026:Tm9sf1 UTSW 14 55642937 start codon destroyed probably null 0.92
Predicted Primers PCR Primer
(F):5'- AAGCCACCAACAGTCATGTGG -3'
(R):5'- GATTCAATCAGCTCTGGCCATC -3'

Sequencing Primer
(F):5'- CATGTGGATGACAGTAGACTTGTACC -3'
(R):5'- AATCAGCTCTGGCCATCTGGAAG -3'
Posted On2016-10-24