Incidental Mutation 'R1078:Gfi1b'
ID85716
Institutional Source Beutler Lab
Gene Symbol Gfi1b
Ensembl Gene ENSMUSG00000026815
Gene Namegrowth factor independent 1B
SynonymsGfi-1B
MMRRC Submission 039164-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1078 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location28609450-28621982 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28613865 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 108 (W108R)
Ref Sequence ENSEMBL: ENSMUSP00000128052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028156] [ENSMUST00000164290]
Predicted Effect probably damaging
Transcript: ENSMUST00000028156
AA Change: W108R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028156
Gene: ENSMUSG00000026815
AA Change: W108R

DomainStartEndE-ValueType
low complexity region 39 55 N/A INTRINSIC
ZnF_C2H2 163 186 2.95e-3 SMART
ZnF_C2H2 192 214 5.5e-3 SMART
ZnF_C2H2 220 242 4.79e-3 SMART
ZnF_C2H2 248 270 1.82e-3 SMART
ZnF_C2H2 276 298 1.47e-3 SMART
ZnF_C2H2 304 327 7.78e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155686
Predicted Effect probably damaging
Transcript: ENSMUST00000164290
AA Change: W108R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128052
Gene: ENSMUSG00000026815
AA Change: W108R

DomainStartEndE-ValueType
low complexity region 39 55 N/A INTRINSIC
ZnF_C2H2 163 186 2.95e-3 SMART
ZnF_C2H2 192 214 5.5e-3 SMART
low complexity region 231 244 N/A INTRINSIC
ZnF_C2H2 253 275 4.79e-3 SMART
ZnF_C2H2 281 303 1.82e-3 SMART
ZnF_C2H2 309 331 1.47e-3 SMART
ZnF_C2H2 337 360 7.78e-3 SMART
Meta Mutation Damage Score 0.4285 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.4%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-finger containing transcriptional regulator that is primarily expressed in cells of hematopoietic lineage. The encoded protein complexes with numerous other transcriptional regulatory proteins including GATA-1, runt-related transcription factor 1 and histone deacetylases to control expression of genes involved in the development and maturation of erythrocytes and megakaryocytes. Mutations in this gene are the cause of the autosomal dominant platelet disorder, platelet-type bleeding disorder-17. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for disruption of this gene die as embryos by day E15. Mature adult red blood cells and megakaryocytes fail to develop. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,611,762 I358S probably benign Het
9130230L23Rik T C 5: 65,988,355 T138A unknown Het
Abi3bp T C 16: 56,654,081 probably null Het
Alpk3 A T 7: 81,078,600 M493L probably benign Het
Bace2 C T 16: 97,356,860 A20V unknown Het
Bms1 T C 6: 118,405,221 D452G probably benign Het
Ccdc187 T C 2: 26,294,377 T3A probably damaging Het
Ctu2 T C 8: 122,481,499 V95A possibly damaging Het
Cyp2a5 A G 7: 26,835,541 K60E probably benign Het
Cyp4f13 T C 17: 32,925,568 H318R probably damaging Het
Dlgap5 G A 14: 47,399,566 T485M probably damaging Het
Dsp C T 13: 38,183,106 probably benign Het
Ell2 T C 13: 75,746,419 probably benign Het
Eml2 A T 7: 19,179,762 Y168F probably benign Het
Ep400 C T 5: 110,735,522 probably benign Het
Ercc4 C A 16: 13,130,197 A336D probably benign Het
Fam189a2 T A 19: 23,973,575 R547S probably benign Het
Fat4 T C 3: 38,983,086 L3629S probably benign Het
Gabbr2 C T 4: 46,664,833 R925H probably damaging Het
Gtse1 C T 15: 85,862,307 P108L probably damaging Het
Hfm1 A T 5: 106,878,830 F140I probably damaging Het
Hyal2 T A 9: 107,572,246 H400Q probably benign Het
Igfn1 A G 1: 135,974,847 Y371H probably damaging Het
Iltifb T G 10: 118,290,151 *180C probably null Het
Kdm2b T C 5: 122,961,541 T118A possibly damaging Het
Lama5 A T 2: 180,179,764 probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lmo7 C T 14: 101,920,474 probably benign Het
Lrrc37a G T 11: 103,497,631 P2323T unknown Het
Lrrc38 A G 4: 143,350,518 Y117C probably benign Het
Myo1e T C 9: 70,383,999 V1024A probably benign Het
Myrfl T C 10: 116,776,732 N904S possibly damaging Het
Olfr1015 T C 2: 85,786,093 V194A possibly damaging Het
Olfr103 T A 17: 37,337,026 I69F probably damaging Het
Olfr1297 T C 2: 111,621,345 H243R probably damaging Het
Pld4 A T 12: 112,763,442 I53F probably benign Het
Plekhg4 T A 8: 105,381,677 C1117* probably null Het
Prss39 G A 1: 34,502,086 E224K probably benign Het
Psme1 G T 14: 55,580,650 G149V probably damaging Het
Soat2 T A 15: 102,153,138 probably null Het
Stab2 C T 10: 86,907,133 probably null Het
Tcf7l2 A G 19: 55,743,195 T127A probably benign Het
Tcp1 T C 17: 12,923,204 probably benign Het
Thbs4 G A 13: 92,762,926 probably benign Het
Tmf1 T C 6: 97,173,300 D482G probably damaging Het
Trim66 G T 7: 109,472,319 P591H probably damaging Het
Umodl1 T C 17: 30,959,373 S108P probably benign Het
Unc79 T G 12: 103,074,853 M715R probably benign Het
Usp34 C A 11: 23,433,175 probably benign Het
Utrn T G 10: 12,455,566 probably null Het
Zfp830 T C 11: 82,765,339 probably null Het
Other mutations in Gfi1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Gfi1b APN 2 28614785 nonsense probably null
IGL01595:Gfi1b APN 2 28611417 critical splice donor site probably null
R0196:Gfi1b UTSW 2 28613774 missense probably damaging 1.00
R0321:Gfi1b UTSW 2 28613885 missense probably damaging 0.98
R1935:Gfi1b UTSW 2 28610113 missense possibly damaging 0.78
R1936:Gfi1b UTSW 2 28610113 missense possibly damaging 0.78
R2311:Gfi1b UTSW 2 28610174 missense probably damaging 1.00
R4646:Gfi1b UTSW 2 28610137 missense probably damaging 0.99
R4911:Gfi1b UTSW 2 28610102 missense probably damaging 1.00
R6031:Gfi1b UTSW 2 28613808 nonsense probably null
R6031:Gfi1b UTSW 2 28613808 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGTGTCCATGCCTGGAGAGTAGC -3'
(R):5'- TACTGGAACCCTCAACAGGAGGTC -3'

Sequencing Primer
(F):5'- TAGCGGAGGCGGAAGTC -3'
(R):5'- gaaaggaagggaagggaagg -3'
Posted On2013-11-18