Mutagenetix > Incidental Mutation

Incidental Mutation 'R7375:Pros1'

572353

Institutional Source

Beutler Lab

Gene Symbol

Pros1

Ensembl Gene

ENSMUSG00000022912

Gene Name

protein S (alpha)

Synonyms

protein S

MMRRC Submission

Accession Numbers

Genbank: NM_011173; MGI: 1095733

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7375 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

62854307-62929346 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 62924550 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 509 (N509K)

Ref Sequence

ENSEMBL: ENSMUSP00000023629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023629]

AlphaFold

Q08761

Predicted Effect

probably damaging
Transcript: ENSMUST00000023629
AA Change: N509K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000023629
Gene: ENSMUSG00000022912
AA Change: N509K

Domain	Start	End	E-Value	Type
GLA	23	86	3.63e-31	SMART
EGF	120	155	4.39e-2	SMART
EGF_CA	157	200	6.91e-9	SMART
EGF_CA	201	242	5.23e-9	SMART
EGF_CA	243	283	1.1e-7	SMART
LamG	321	458	8.55e-22	SMART
LamG	506	646	1.57e-1	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: This gene encodes a vitamin K-dependent protein with key roles in multiple biological processes including coagulation, apoptosis and vasculogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein which is secreted into the plasma. Mice lacking the encoded protein die in utero from a fulminant coagulopathy and associated hemorrhages. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with thrombosis, hemorrhage, and thrombocytopenia. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(2)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb4	A	G	5: 8,918,671	I337V	probably benign	Het
Abl2	A	G	1: 156,622,614	D117G	probably damaging	Het
Arhgap5	T	A	12: 52,516,582	L112*	probably null	Het
Brinp3	C	G	1: 146,902,010	L732V	possibly damaging	Het
Cmya5	T	G	13: 93,091,661	K2306N	probably damaging	Het
Col16a1	A	C	4: 130,065,501	K680T	unknown	Het
Col28a1	T	A	6: 7,998,499	T1137S	possibly damaging	Het
Crnn	A	T	3: 93,149,145	T413S	possibly damaging	Het
Csf1	A	G	3: 107,748,179	L512P	possibly damaging	Het
Dlx3	C	A	11: 95,120,635	A105D	possibly damaging	Het
Dnah3	T	G	7: 119,951,677	T161P	probably damaging	Het
Dnah7b	A	G	1: 46,303,634	D3435G	probably damaging	Het
Dpp10	A	G	1: 123,367,795	I541T	probably benign	Het
Efcc1	T	C	6: 87,751,856	V431A	possibly damaging	Het
Enpp5	T	C	17: 44,080,977	I99T	probably benign	Het
Fam192a	G	A	8: 94,583,008	L119F	probably benign	Het
Gm11232	C	T	4: 71,757,346	W59*	probably null	Het
Gm17660	G	T	5: 104,071,257		probably null	Het
Gm8251	A	T	1: 44,060,534	I468N	possibly damaging	Het
Gxylt2	A	T	6: 100,750,422	T166S	probably benign	Het
Herc6	A	T	6: 57,651,806		probably null	Het
Itga2	T	C	13: 114,869,217	I476V	probably benign	Het
Kcnq5	T	C	1: 21,469,486	T403A	possibly damaging	Het
Klhl42	A	G	6: 147,092,040	K170R	probably benign	Het
Klk13	T	C	7: 43,721,158		probably null	Het
Krt32	G	T	11: 100,081,224	R433S	probably benign	Het
Lrp1	G	T	10: 127,539,348	T4461N	probably damaging	Het
Maats1	T	A	16: 38,335,618	H81L	probably damaging	Het
Mapk10	A	T	5: 102,976,390	M256K	probably null	Het
Mogat2	T	C	7: 99,223,698	K93R	probably damaging	Het
Myh1	G	T	11: 67,210,428	V677L	probably damaging	Het
Naip5	T	C	13: 100,219,696	Q1137R	probably benign	Het
Naip5	G	T	13: 100,219,697	Q1137K	not run	Het
Olfr1242	C	T	2: 89,493,692	G207R	possibly damaging	Het
Oog4	G	A	4: 143,438,974	T201M	possibly damaging	Het
Pik3c2a	T	C	7: 116,376,386	T649A	probably damaging	Het
Plec	T	A	15: 76,177,355	H2794L	possibly damaging	Het
Psme4	T	A	11: 30,772,700		probably null	Het
Ptprf	A	G	4: 118,212,814	V1457A	probably benign	Het
Rad50	A	G	11: 53,652,228		probably null	Het
Rfx5	C	T	3: 94,958,742	P451S	unknown	Het
Sdk1	G	T	5: 141,998,843	V728L	probably benign	Het
Sfxn4	T	C	19: 60,858,674	D57G	probably benign	Het
Slc10a4	A	G	5: 73,012,307	D425G	probably benign	Het
Slc17a5	C	T	9: 78,587,892	A26T	probably benign	Het
Slc22a26	A	T	19: 7,783,144		probably null	Het
Slc22a30	A	G	19: 8,404,691	L72P	probably damaging	Het
Slco6c1	T	C	1: 97,081,421	T447A	possibly damaging	Het
Slco6d1	A	G	1: 98,421,447	N81S	probably damaging	Het
Stard9	T	C	2: 120,665,002		probably null	Het
Tecpr1	T	C	5: 144,208,599	E610G	possibly damaging	Het
Tmem81	G	T	1: 132,507,563	V36L	possibly damaging	Het
Trabd2b	G	T	4: 114,609,997	K474N	probably benign	Het
Tspan33	T	C	6: 29,713,520	F149L	probably benign	Het
Ttn	A	G	2: 76,776,339	Y18076H	probably damaging	Het
Utrn	G	A	10: 12,641,020	R2277C	probably damaging	Het
Vmn2r101	T	A	17: 19,611,390	D549E	probably damaging	Het
Vmn2r107	T	A	17: 20,355,876	I156K	probably benign	Het
Wwc2	T	G	8: 47,863,920	S713R	unknown	Het
Xndc1	C	A	7: 102,081,480		probably null	Het
Zfp810	A	G	9: 22,290,537		probably null	Het

Other mutations in Pros1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00937:Pros1	APN	16	62910045	missense	probably damaging	0.99
IGL01300:Pros1	APN	16	62913811	missense	possibly damaging	0.85
IGL02709:Pros1	APN	16	62898945	missense	probably damaging	0.99
IGL03080:Pros1	APN	16	62918143	missense	probably damaging	0.98
IGL03095:Pros1	APN	16	62907769	nonsense	probably null
F6893:Pros1	UTSW	16	62924639	missense	probably damaging	0.98
R0124:Pros1	UTSW	16	62913946	missense	possibly damaging	0.95
R0517:Pros1	UTSW	16	62903518	missense	probably benign	0.03
R1113:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1308:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1355:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1370:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1517:Pros1	UTSW	16	62885512	missense	probably damaging	0.98
R1866:Pros1	UTSW	16	62928135	missense	possibly damaging	0.86
R1876:Pros1	UTSW	16	62903518	missense	probably damaging	0.96
R2255:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R2364:Pros1	UTSW	16	62913848	missense	probably damaging	0.99
R2369:Pros1	UTSW	16	62928069	missense	probably damaging	1.00
R2979:Pros1	UTSW	16	62913866	missense	probably damaging	0.99
R3724:Pros1	UTSW	16	62900329	missense	possibly damaging	0.86
R4056:Pros1	UTSW	16	62900645	nonsense	probably null
R4556:Pros1	UTSW	16	62900673	missense	possibly damaging	0.95
R4688:Pros1	UTSW	16	62889007	critical splice donor site	probably null
R4850:Pros1	UTSW	16	62885524	missense	probably damaging	0.98
R4923:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R5008:Pros1	UTSW	16	62928185	missense	possibly damaging	0.53
R5370:Pros1	UTSW	16	62913976	missense	probably benign	0.01
R5580:Pros1	UTSW	16	62926326	critical splice acceptor site	probably null
R5930:Pros1	UTSW	16	62928061	missense	probably damaging	0.96
R5974:Pros1	UTSW	16	62900667	missense	probably damaging	0.98
R6233:Pros1	UTSW	16	62898921	missense	possibly damaging	0.47
R6949:Pros1	UTSW	16	62924575	missense	probably benign	0.01
R7055:Pros1	UTSW	16	62928102	missense	possibly damaging	0.85
R7347:Pros1	UTSW	16	62919523	missense	probably damaging	0.97
R7419:Pros1	UTSW	16	62928070	nonsense	probably null
R7980:Pros1	UTSW	16	62928153	missense	possibly damaging	0.86
R8234:Pros1	UTSW	16	62928177	missense	possibly damaging	0.73
R8479:Pros1	UTSW	16	62907739	missense	probably damaging	1.00
R8514:Pros1	UTSW	16	62910109	missense	probably benign	0.03
R8827:Pros1	UTSW	16	62926464	missense	probably benign	0.13
R9131:Pros1	UTSW	16	62928034	missense	probably damaging	0.96
R9484:Pros1	UTSW	16	62924524	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- GTGCTATAAGGTCTGACCGC -3'
(R):5'- CTCCTTGGAAATCAGTCAACAAG -3'

Sequencing Primer
(F):5'- CTATAAGGTCTGACCGCTCTGAG -3'
(R):5'- CCTTGGAAATCAGTCAACAAGTAGGG -3'

Posted On

2019-09-13