Incidental Mutation 'R7375:Pros1'
ID 572353
Institutional Source Beutler Lab
Gene Symbol Pros1
Ensembl Gene ENSMUSG00000022912
Gene Name protein S (alpha)
Synonyms protein S
MMRRC Submission
Accession Numbers

Genbank: NM_011173; MGI: 1095733  

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7375 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 62854307-62929346 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 62924550 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 509 (N509K)
Ref Sequence ENSEMBL: ENSMUSP00000023629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023629]
AlphaFold Q08761
Predicted Effect probably damaging
Transcript: ENSMUST00000023629
AA Change: N509K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023629
Gene: ENSMUSG00000022912
AA Change: N509K

DomainStartEndE-ValueType
GLA 23 86 3.63e-31 SMART
EGF 120 155 4.39e-2 SMART
EGF_CA 157 200 6.91e-9 SMART
EGF_CA 201 242 5.23e-9 SMART
EGF_CA 243 283 1.1e-7 SMART
LamG 321 458 8.55e-22 SMART
LamG 506 646 1.57e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: This gene encodes a vitamin K-dependent protein with key roles in multiple biological processes including coagulation, apoptosis and vasculogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein which is secreted into the plasma. Mice lacking the encoded protein die in utero from a fulminant coagulopathy and associated hemorrhages. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with thrombosis, hemorrhage, and thrombocytopenia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A G 5: 8,918,671 I337V probably benign Het
Abl2 A G 1: 156,622,614 D117G probably damaging Het
Arhgap5 T A 12: 52,516,582 L112* probably null Het
Brinp3 C G 1: 146,902,010 L732V possibly damaging Het
Cmya5 T G 13: 93,091,661 K2306N probably damaging Het
Col16a1 A C 4: 130,065,501 K680T unknown Het
Col28a1 T A 6: 7,998,499 T1137S possibly damaging Het
Crnn A T 3: 93,149,145 T413S possibly damaging Het
Csf1 A G 3: 107,748,179 L512P possibly damaging Het
Dlx3 C A 11: 95,120,635 A105D possibly damaging Het
Dnah3 T G 7: 119,951,677 T161P probably damaging Het
Dnah7b A G 1: 46,303,634 D3435G probably damaging Het
Dpp10 A G 1: 123,367,795 I541T probably benign Het
Efcc1 T C 6: 87,751,856 V431A possibly damaging Het
Enpp5 T C 17: 44,080,977 I99T probably benign Het
Fam192a G A 8: 94,583,008 L119F probably benign Het
Gm11232 C T 4: 71,757,346 W59* probably null Het
Gm17660 G T 5: 104,071,257 probably null Het
Gm8251 A T 1: 44,060,534 I468N possibly damaging Het
Gxylt2 A T 6: 100,750,422 T166S probably benign Het
Herc6 A T 6: 57,651,806 probably null Het
Itga2 T C 13: 114,869,217 I476V probably benign Het
Kcnq5 T C 1: 21,469,486 T403A possibly damaging Het
Klhl42 A G 6: 147,092,040 K170R probably benign Het
Klk13 T C 7: 43,721,158 probably null Het
Krt32 G T 11: 100,081,224 R433S probably benign Het
Lrp1 G T 10: 127,539,348 T4461N probably damaging Het
Maats1 T A 16: 38,335,618 H81L probably damaging Het
Mapk10 A T 5: 102,976,390 M256K probably null Het
Mogat2 T C 7: 99,223,698 K93R probably damaging Het
Myh1 G T 11: 67,210,428 V677L probably damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Olfr1242 C T 2: 89,493,692 G207R possibly damaging Het
Oog4 G A 4: 143,438,974 T201M possibly damaging Het
Pik3c2a T C 7: 116,376,386 T649A probably damaging Het
Plec T A 15: 76,177,355 H2794L possibly damaging Het
Psme4 T A 11: 30,772,700 probably null Het
Ptprf A G 4: 118,212,814 V1457A probably benign Het
Rad50 A G 11: 53,652,228 probably null Het
Rfx5 C T 3: 94,958,742 P451S unknown Het
Sdk1 G T 5: 141,998,843 V728L probably benign Het
Sfxn4 T C 19: 60,858,674 D57G probably benign Het
Slc10a4 A G 5: 73,012,307 D425G probably benign Het
Slc17a5 C T 9: 78,587,892 A26T probably benign Het
Slc22a26 A T 19: 7,783,144 probably null Het
Slc22a30 A G 19: 8,404,691 L72P probably damaging Het
Slco6c1 T C 1: 97,081,421 T447A possibly damaging Het
Slco6d1 A G 1: 98,421,447 N81S probably damaging Het
Stard9 T C 2: 120,665,002 probably null Het
Tecpr1 T C 5: 144,208,599 E610G possibly damaging Het
Tmem81 G T 1: 132,507,563 V36L possibly damaging Het
Trabd2b G T 4: 114,609,997 K474N probably benign Het
Tspan33 T C 6: 29,713,520 F149L probably benign Het
Ttn A G 2: 76,776,339 Y18076H probably damaging Het
Utrn G A 10: 12,641,020 R2277C probably damaging Het
Vmn2r101 T A 17: 19,611,390 D549E probably damaging Het
Vmn2r107 T A 17: 20,355,876 I156K probably benign Het
Wwc2 T G 8: 47,863,920 S713R unknown Het
Xndc1 C A 7: 102,081,480 probably null Het
Zfp810 A G 9: 22,290,537 probably null Het
Other mutations in Pros1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Pros1 APN 16 62910045 missense probably damaging 0.99
IGL01300:Pros1 APN 16 62913811 missense possibly damaging 0.85
IGL02709:Pros1 APN 16 62898945 missense probably damaging 0.99
IGL03080:Pros1 APN 16 62918143 missense probably damaging 0.98
IGL03095:Pros1 APN 16 62907769 nonsense probably null
F6893:Pros1 UTSW 16 62924639 missense probably damaging 0.98
R0124:Pros1 UTSW 16 62913946 missense possibly damaging 0.95
R0517:Pros1 UTSW 16 62903518 missense probably benign 0.03
R1113:Pros1 UTSW 16 62913865 missense probably damaging 0.99
R1308:Pros1 UTSW 16 62913865 missense probably damaging 0.99
R1355:Pros1 UTSW 16 62919558 missense probably benign 0.23
R1370:Pros1 UTSW 16 62919558 missense probably benign 0.23
R1517:Pros1 UTSW 16 62885512 missense probably damaging 0.98
R1866:Pros1 UTSW 16 62928135 missense possibly damaging 0.86
R1876:Pros1 UTSW 16 62903518 missense probably damaging 0.96
R2255:Pros1 UTSW 16 62903572 missense possibly damaging 0.86
R2364:Pros1 UTSW 16 62913848 missense probably damaging 0.99
R2369:Pros1 UTSW 16 62928069 missense probably damaging 1.00
R2979:Pros1 UTSW 16 62913866 missense probably damaging 0.99
R3724:Pros1 UTSW 16 62900329 missense possibly damaging 0.86
R4056:Pros1 UTSW 16 62900645 nonsense probably null
R4556:Pros1 UTSW 16 62900673 missense possibly damaging 0.95
R4688:Pros1 UTSW 16 62889007 critical splice donor site probably null
R4850:Pros1 UTSW 16 62885524 missense probably damaging 0.98
R4923:Pros1 UTSW 16 62903572 missense possibly damaging 0.86
R5008:Pros1 UTSW 16 62928185 missense possibly damaging 0.53
R5370:Pros1 UTSW 16 62913976 missense probably benign 0.01
R5580:Pros1 UTSW 16 62926326 critical splice acceptor site probably null
R5930:Pros1 UTSW 16 62928061 missense probably damaging 0.96
R5974:Pros1 UTSW 16 62900667 missense probably damaging 0.98
R6233:Pros1 UTSW 16 62898921 missense possibly damaging 0.47
R6949:Pros1 UTSW 16 62924575 missense probably benign 0.01
R7055:Pros1 UTSW 16 62928102 missense possibly damaging 0.85
R7347:Pros1 UTSW 16 62919523 missense probably damaging 0.97
R7419:Pros1 UTSW 16 62928070 nonsense probably null
R7980:Pros1 UTSW 16 62928153 missense possibly damaging 0.86
R8234:Pros1 UTSW 16 62928177 missense possibly damaging 0.73
R8479:Pros1 UTSW 16 62907739 missense probably damaging 1.00
R8514:Pros1 UTSW 16 62910109 missense probably benign 0.03
R8827:Pros1 UTSW 16 62926464 missense probably benign 0.13
R9131:Pros1 UTSW 16 62928034 missense probably damaging 0.96
R9484:Pros1 UTSW 16 62924524 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GTGCTATAAGGTCTGACCGC -3'
(R):5'- CTCCTTGGAAATCAGTCAACAAG -3'

Sequencing Primer
(F):5'- CTATAAGGTCTGACCGCTCTGAG -3'
(R):5'- CCTTGGAAATCAGTCAACAAGTAGGG -3'
Posted On 2019-09-13