Incidental Mutation 'R1398:Nrros'
ID 160261
Institutional Source Beutler Lab
Gene Symbol Nrros
Ensembl Gene ENSMUSG00000052384
Gene Name negative regulator of reactive oxygen species
Synonyms E430025L02Rik, Lrrc33
MMRRC Submission 039460-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1398 (G1)
Quality Score 212
Status Validated
Chromosome 16
Chromosomal Location 31961603-31984412 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 31961962 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 649 (I649N)
Ref Sequence ENSEMBL: ENSMUSP00000155965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099991] [ENSMUST00000115163] [ENSMUST00000115165] [ENSMUST00000126869] [ENSMUST00000130410] [ENSMUST00000143682] [ENSMUST00000144345] [ENSMUST00000231836]
AlphaFold Q8BMT4
Predicted Effect probably damaging
Transcript: ENSMUST00000099991
AA Change: I657N

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097571
Gene: ENSMUSG00000052384
AA Change: I657N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
LRR 80 103 1.01e2 SMART
LRR 131 155 5.27e1 SMART
LRR 156 179 4.05e-1 SMART
LRR_TYP 180 203 7.67e-2 SMART
LRR 204 227 1.49e1 SMART
LRR_TYP 327 350 1.67e-2 SMART
LRR 376 400 3.27e1 SMART
LRR_TYP 401 424 1.79e-2 SMART
LRR 461 484 1.45e1 SMART
LRR 535 556 1.76e1 SMART
LRR 559 580 3.36e1 SMART
transmembrane domain 653 675 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115163
AA Change: I685N

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110817
Gene: ENSMUSG00000052384
AA Change: I685N

DomainStartEndE-ValueType
LRRNT 59 89 1.05e1 SMART
LRR 108 131 1.01e2 SMART
LRR 159 183 5.27e1 SMART
LRR 184 207 4.05e-1 SMART
LRR_TYP 208 231 7.67e-2 SMART
LRR 232 255 1.49e1 SMART
LRR_TYP 355 378 1.67e-2 SMART
LRR 404 428 3.27e1 SMART
LRR_TYP 429 452 1.79e-2 SMART
LRR 489 512 1.45e1 SMART
LRR 563 584 1.76e1 SMART
LRR 587 608 3.36e1 SMART
transmembrane domain 681 703 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115165
AA Change: I633N

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110819
Gene: ENSMUSG00000052384
AA Change: I633N

DomainStartEndE-ValueType
Blast:LRRNT 8 37 5e-8 BLAST
LRR 56 79 1.01e2 SMART
LRR 107 131 5.27e1 SMART
LRR 132 155 4.05e-1 SMART
LRR_TYP 156 179 7.67e-2 SMART
LRR 180 203 1.49e1 SMART
LRR_TYP 303 326 1.67e-2 SMART
LRR 352 376 3.27e1 SMART
LRR_TYP 377 400 1.79e-2 SMART
LRR 437 460 1.45e1 SMART
LRR 511 532 1.76e1 SMART
LRR 535 556 3.36e1 SMART
transmembrane domain 629 651 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126869
AA Change: I657N

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116388
Gene: ENSMUSG00000052384
AA Change: I657N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
LRR 80 103 1.01e2 SMART
LRR 131 155 5.27e1 SMART
LRR 156 179 4.05e-1 SMART
LRR_TYP 180 203 7.67e-2 SMART
LRR 204 227 1.49e1 SMART
LRR_TYP 327 350 1.67e-2 SMART
LRR 376 400 3.27e1 SMART
LRR_TYP 401 424 1.79e-2 SMART
LRR 461 484 1.45e1 SMART
LRR 535 556 1.76e1 SMART
LRR 559 580 3.36e1 SMART
transmembrane domain 653 675 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127287
Predicted Effect probably benign
Transcript: ENSMUST00000130410
SMART Domains Protein: ENSMUSP00000122290
Gene: ENSMUSG00000052384

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
Pfam:LRR_7 81 97 1.9e-2 PFAM
Pfam:LRR_7 105 121 6.8e-2 PFAM
Pfam:LRR_7 133 144 2e-1 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136809
Predicted Effect probably damaging
Transcript: ENSMUST00000143682
AA Change: I657N

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119349
Gene: ENSMUSG00000052384
AA Change: I657N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
LRR 80 103 1.01e2 SMART
LRR 131 155 5.27e1 SMART
LRR 156 179 4.05e-1 SMART
LRR_TYP 180 203 7.67e-2 SMART
LRR 204 227 1.49e1 SMART
LRR_TYP 327 350 1.67e-2 SMART
LRR 376 400 3.27e1 SMART
LRR_TYP 401 424 1.79e-2 SMART
LRR 461 484 1.45e1 SMART
LRR 535 556 1.76e1 SMART
LRR 559 580 3.36e1 SMART
transmembrane domain 653 675 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144345
SMART Domains Protein: ENSMUSP00000121492
Gene: ENSMUSG00000052384

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 31 61 1.05e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150250
Predicted Effect probably damaging
Transcript: ENSMUST00000231836
AA Change: I649N

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.0954 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 96% (75/78)
MGI Phenotype PHENOTYPE: Homozygous knockout leads to increased oxidative stress and susceptibility to experimental autoimmune encephalomyelitis, but to reduced susceptibility to bacterial infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,547,511 (GRCm39) K288E probably damaging Het
Aldh3a2 T C 11: 61,147,562 (GRCm39) probably null Het
Anks1b A G 10: 89,885,891 (GRCm39) T196A probably damaging Het
Anks6 T A 4: 47,044,926 (GRCm39) T327S possibly damaging Het
Bdh2 T C 3: 135,001,057 (GRCm39) probably benign Het
C4b T A 17: 34,949,693 (GRCm39) probably benign Het
Cacna2d1 G A 5: 16,562,764 (GRCm39) V847I possibly damaging Het
Cadps G T 14: 12,449,822 (GRCm38) T1129K probably damaging Het
Cdc45 A G 16: 18,600,721 (GRCm39) probably benign Het
Cep63 A T 9: 102,480,285 (GRCm39) probably benign Het
Chil4 T A 3: 106,126,825 (GRCm39) probably null Het
Cnot11 A G 1: 39,584,261 (GRCm39) R478G probably damaging Het
Cyp2c67 A G 19: 39,627,069 (GRCm39) S254P probably damaging Het
Dnah11 T A 12: 118,020,841 (GRCm39) K87* probably null Het
Dpy19l2 T A 9: 24,492,559 (GRCm39) probably benign Het
Dsc1 A T 18: 20,221,393 (GRCm39) I694N probably damaging Het
Ehd4 A T 2: 119,958,081 (GRCm39) I168K probably benign Het
Eif4e A T 3: 138,252,136 (GRCm39) N25Y probably damaging Het
Elapor2 A G 5: 9,430,297 (GRCm39) Y69C probably damaging Het
Eme2 G A 17: 25,111,892 (GRCm39) S263F probably damaging Het
Fgfrl1 T A 5: 108,854,147 (GRCm39) probably benign Het
Fhip2a T A 19: 57,361,358 (GRCm39) probably benign Het
Gm3159 T A 14: 4,398,586 (GRCm38) Y92* probably null Het
Gm4922 T A 10: 18,659,496 (GRCm39) S409C possibly damaging Het
Gmcl1 G A 6: 86,691,244 (GRCm39) probably benign Het
Grsf1 A G 5: 88,813,706 (GRCm39) Y231H probably benign Het
Heatr4 T A 12: 84,014,395 (GRCm39) H614L possibly damaging Het
Hoxa13 C G 6: 52,260,647 (GRCm38) probably benign Het
Hoxa13 G C 6: 52,260,648 (GRCm38) probably benign Het
Isg20l2 C A 3: 87,846,061 (GRCm39) L325I probably benign Het
Kalrn A G 16: 34,033,190 (GRCm39) Y879H probably damaging Het
Kcnk10 C A 12: 98,402,485 (GRCm39) W318L probably damaging Het
Kctd1 T C 18: 15,195,654 (GRCm39) E323G possibly damaging Het
Kif4 G T X: 99,732,703 (GRCm39) A492S probably benign Het
Krtap4-1 T C 11: 99,518,558 (GRCm39) T151A unknown Het
Ldlr A T 9: 21,650,838 (GRCm39) Q449L probably benign Het
Lepr T A 4: 101,649,216 (GRCm39) D872E probably damaging Het
Lgals12 C T 19: 7,581,322 (GRCm39) probably benign Het
Lrig3 C T 10: 125,838,957 (GRCm39) P488L probably benign Het
Lrrc4b A C 7: 44,111,876 (GRCm39) I583L probably benign Het
Lyst T C 13: 13,915,121 (GRCm39) S3272P possibly damaging Het
Marchf2 T C 17: 33,915,096 (GRCm39) H166R probably damaging Het
Mtbp C A 15: 55,440,933 (GRCm39) Y373* probably null Het
Myh2 C T 11: 67,076,113 (GRCm39) H767Y probably benign Het
Ncam1 G A 9: 49,428,889 (GRCm39) probably benign Het
Neb T A 2: 52,179,658 (GRCm39) N1282Y probably damaging Het
Nectin3 A G 16: 46,269,119 (GRCm39) Y428H possibly damaging Het
Nvl A T 1: 180,924,691 (GRCm39) probably benign Het
Or5p70 T A 7: 107,994,708 (GRCm39) V127E probably damaging Het
Pms1 A T 1: 53,246,435 (GRCm39) V368E possibly damaging Het
Polq T A 16: 36,882,857 (GRCm39) S1674T possibly damaging Het
Ppp1r21 T C 17: 88,850,307 (GRCm39) V31A probably damaging Het
Rev3l T A 10: 39,697,579 (GRCm39) V692E probably benign Het
Robo4 T C 9: 37,319,372 (GRCm39) probably null Het
Rps6kc1 T C 1: 190,532,212 (GRCm39) I597V probably damaging Het
Rtel1 T A 2: 180,977,658 (GRCm39) probably null Het
Scn9a A G 2: 66,314,930 (GRCm39) M1587T probably benign Het
Sec31b T A 19: 44,512,104 (GRCm39) I597F probably benign Het
Skint5 T C 4: 113,636,268 (GRCm39) N650S unknown Het
Slc22a28 G T 19: 8,107,566 (GRCm39) S167* probably null Het
Slfn1 T A 11: 83,011,968 (GRCm39) M28K probably damaging Het
Smc6 T C 12: 11,321,880 (GRCm39) probably benign Het
Sox8 T C 17: 25,786,857 (GRCm39) H282R probably benign Het
Spata31e2 G T 1: 26,724,422 (GRCm39) Q253K possibly damaging Het
Syngr3 C A 17: 24,905,414 (GRCm39) V161L probably benign Het
Trak1 C T 9: 121,283,425 (GRCm39) S397F probably damaging Het
Uso1 C T 5: 92,329,327 (GRCm39) A405V probably benign Het
Uvrag G T 7: 98,715,027 (GRCm39) Y190* probably null Het
Vps13d A T 4: 144,826,553 (GRCm39) L1726Q probably null Het
Vwf A T 6: 125,580,420 (GRCm39) Q556L probably benign Het
Wdr70 T A 15: 8,065,325 (GRCm39) M246L probably benign Het
Yipf3 T C 17: 46,562,372 (GRCm39) F285S probably damaging Het
Zdhhc13 G A 7: 48,476,621 (GRCm39) G579R probably damaging Het
Zdhhc18 G C 4: 133,354,608 (GRCm39) F125L probably benign Het
Other mutations in Nrros
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Nrros APN 16 31,966,438 (GRCm39) missense probably benign 0.06
IGL01097:Nrros APN 16 31,963,003 (GRCm39) missense possibly damaging 0.71
IGL02065:Nrros APN 16 31,963,492 (GRCm39) missense possibly damaging 0.84
IGL03372:Nrros APN 16 31,963,588 (GRCm39) missense probably damaging 1.00
R0615:Nrros UTSW 16 31,962,903 (GRCm39) missense probably damaging 1.00
R0669:Nrros UTSW 16 31,962,241 (GRCm39) missense probably damaging 1.00
R0840:Nrros UTSW 16 31,962,241 (GRCm39) missense probably damaging 1.00
R1796:Nrros UTSW 16 31,962,329 (GRCm39) missense probably damaging 1.00
R2031:Nrros UTSW 16 31,962,975 (GRCm39) nonsense probably null
R2033:Nrros UTSW 16 31,962,975 (GRCm39) nonsense probably null
R2034:Nrros UTSW 16 31,962,975 (GRCm39) nonsense probably null
R2087:Nrros UTSW 16 31,962,975 (GRCm39) nonsense probably null
R2089:Nrros UTSW 16 31,962,975 (GRCm39) nonsense probably null
R2090:Nrros UTSW 16 31,962,975 (GRCm39) nonsense probably null
R2091:Nrros UTSW 16 31,962,975 (GRCm39) nonsense probably null
R2091:Nrros UTSW 16 31,962,975 (GRCm39) nonsense probably null
R2151:Nrros UTSW 16 31,962,076 (GRCm39) missense probably benign 0.11
R2438:Nrros UTSW 16 31,963,117 (GRCm39) missense probably benign 0.25
R2438:Nrros UTSW 16 31,962,929 (GRCm39) splice site probably null
R5474:Nrros UTSW 16 31,963,170 (GRCm39) missense probably benign 0.00
R5527:Nrros UTSW 16 31,963,288 (GRCm39) missense probably damaging 1.00
R5629:Nrros UTSW 16 31,963,223 (GRCm39) missense probably damaging 1.00
R5888:Nrros UTSW 16 31,961,905 (GRCm39) missense probably benign 0.15
R5939:Nrros UTSW 16 31,962,272 (GRCm39) missense probably benign 0.01
R5982:Nrros UTSW 16 31,963,411 (GRCm39) missense probably damaging 0.96
R6869:Nrros UTSW 16 31,963,249 (GRCm39) missense probably damaging 1.00
R6912:Nrros UTSW 16 31,981,057 (GRCm39) missense probably null 0.01
R7010:Nrros UTSW 16 31,962,398 (GRCm39) missense probably damaging 0.96
R7469:Nrros UTSW 16 31,963,030 (GRCm39) missense probably benign 0.14
R7673:Nrros UTSW 16 31,981,099 (GRCm39) missense unknown
R7770:Nrros UTSW 16 31,962,346 (GRCm39) missense probably benign 0.01
R7948:Nrros UTSW 16 31,981,076 (GRCm39) missense unknown
R8375:Nrros UTSW 16 31,966,456 (GRCm39) missense probably damaging 1.00
R8702:Nrros UTSW 16 31,966,589 (GRCm39) intron probably benign
R9740:Nrros UTSW 16 31,963,667 (GRCm39) missense possibly damaging 0.95
X0022:Nrros UTSW 16 31,961,858 (GRCm39) missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ATCAGACTGTCACCCTTAGCCTGC -3'
(R):5'- CTCAGCCAGAACCCTTATGACTGC -3'

Sequencing Primer
(F):5'- ACCCTTAGCCTGCATGGATG -3'
(R):5'- CCTTATGACTGCTGTGGGGTG -3'
Posted On 2014-03-14