Mutagenetix > Incidental Mutation

Incidental Mutation 'R1398:Cep63'

160241

Institutional Source

Beutler Lab

Gene Symbol

Cep63

Ensembl Gene

ENSMUSG00000032534

Gene Name

centrosomal protein 63

Synonyms

D9Mgc48e, CD20R, D9Mgc41, ET2

MMRRC Submission

039460-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.731) question?

Stock #

R1398 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102584588-102626534 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 102603086 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000149157 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093791] [ENSMUST00000162655] [ENSMUST00000213636] [ENSMUST00000216281]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000093791

SMART Domains

Protein: ENSMUSP00000091306
Gene: ENSMUSG00000032534

Domain	Start	End	E-Value	Type
low complexity region	12	25	N/A	INTRINSIC
Pfam:CEP63	76	338	8.1e-112	PFAM
coiled coil region	401	469	N/A	INTRINSIC
coiled coil region	492	591	N/A	INTRINSIC
low complexity region	651	663	N/A	INTRINSIC
low complexity region	705	716	N/A	INTRINSIC
coiled coil region	730	749	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160512

Predicted Effect

probably benign
Transcript: ENSMUST00000162655

SMART Domains

Protein: ENSMUSP00000125621
Gene: ENSMUSG00000032534

Domain	Start	End	E-Value	Type
coiled coil region	72	220	N/A	INTRINSIC
coiled coil region	243	283	N/A	INTRINSIC
coiled coil region	343	411	N/A	INTRINSIC
coiled coil region	434	484	N/A	INTRINSIC
coiled coil region	510	529	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162960

Predicted Effect

probably benign
Transcript: ENSMUST00000213636

Predicted Effect

probably benign
Transcript: ENSMUST00000215253

Predicted Effect

probably benign
Transcript: ENSMUST00000216281

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.7%

Validation Efficiency

96% (75/78)

MGI Phenotype

FUNCTION: This gene encodes a subunit of the centrosome, the main microtubule-organizing center of the cell. The encoded protein associates with another centrosomal protein, CEP152, to regulate mother-centriole-dependent centriole duplication in dividing cells. Disruption of a similar gene in human has been associated with primary microcephaly (MCPH). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth defects, microcephaly, thin cerebral cortex, mitotic defects and cell death in neural progenitors, decreased oocyte number, small testis, and severely impaired spermatogenesis and meiotic recombination leading to male infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	G	T	1: 26,685,341	Q253K	possibly damaging	Het
9330182L06Rik	A	G	5: 9,380,297	Y69C	probably damaging	Het
Abca17	T	C	17: 24,328,537	K288E	probably damaging	Het
Aldh3a2	T	C	11: 61,256,736		probably null	Het
Anks1b	A	G	10: 90,050,029	T196A	probably damaging	Het
Anks6	T	A	4: 47,044,926	T327S	possibly damaging	Het
Bdh2	T	C	3: 135,295,296		probably benign	Het
C4b	T	A	17: 34,730,719		probably benign	Het
Cacna2d1	G	A	5: 16,357,766	V847I	possibly damaging	Het
Cadps	G	T	14: 12,449,822	T1129K	probably damaging	Het
Cdc45	A	G	16: 18,781,971		probably benign	Het
Chil4	T	A	3: 106,219,509		probably null	Het
Cnot11	A	G	1: 39,545,180	R478G	probably damaging	Het
Cyp2c67	A	G	19: 39,638,625	S254P	probably damaging	Het
Dnah11	T	A	12: 118,057,106	K87*	probably null	Het
Dpy19l2	T	A	9: 24,581,263		probably benign	Het
Dsc1	A	T	18: 20,088,336	I694N	probably damaging	Het
Ehd4	A	T	2: 120,127,600	I168K	probably benign	Het
Eif4e	A	T	3: 138,546,375	N25Y	probably damaging	Het
Eme2	G	A	17: 24,892,918	S263F	probably damaging	Het
Fam160b1	T	A	19: 57,372,926		probably benign	Het
Fgfrl1	T	A	5: 108,706,281		probably benign	Het
Gm3159	T	A	14: 4,398,586	Y92*	probably null	Het
Gm4922	T	A	10: 18,783,748	S409C	possibly damaging	Het
Gmcl1	G	A	6: 86,714,262		probably benign	Het
Grsf1	A	G	5: 88,665,847	Y231H	probably benign	Het
Heatr4	T	A	12: 83,967,621	H614L	possibly damaging	Het
Hoxa13	C	G	6: 52,260,647		probably benign	Het
Hoxa13	G	C	6: 52,260,648		probably benign	Het
Isg20l2	C	A	3: 87,938,754	L325I	probably benign	Het
Kalrn	A	G	16: 34,212,820	Y879H	probably damaging	Het
Kcnk10	C	A	12: 98,436,226	W318L	probably damaging	Het
Kctd1	T	C	18: 15,062,597	E323G	possibly damaging	Het
Kif4	G	T	X: 100,689,097	A492S	probably benign	Het
Krtap4-1	T	C	11: 99,627,732	T151A	unknown	Het
Ldlr	A	T	9: 21,739,542	Q449L	probably benign	Het
Lepr	T	A	4: 101,792,019	D872E	probably damaging	Het
Lgals12	C	T	19: 7,603,957		probably benign	Het
Lrig3	C	T	10: 126,003,088	P488L	probably benign	Het
Lrrc4b	A	C	7: 44,462,452	I583L	probably benign	Het
Lyst	T	C	13: 13,740,536	S3272P	possibly damaging	Het
March2	T	C	17: 33,696,122	H166R	probably damaging	Het
Mtbp	C	A	15: 55,577,537	Y373*	probably null	Het
Myh2	C	T	11: 67,185,287	H767Y	probably benign	Het
Ncam1	G	A	9: 49,517,589		probably benign	Het
Neb	T	A	2: 52,289,646	N1282Y	probably damaging	Het
Nectin3	A	G	16: 46,448,756	Y428H	possibly damaging	Het
Nrros	A	T	16: 32,143,144	I649N	probably damaging	Het
Nvl	A	T	1: 181,097,126		probably benign	Het
Olfr495	T	A	7: 108,395,501	V127E	probably damaging	Het
Pms1	A	T	1: 53,207,276	V368E	possibly damaging	Het
Polq	T	A	16: 37,062,495	S1674T	possibly damaging	Het
Ppp1r21	T	C	17: 88,542,879	V31A	probably damaging	Het
Rev3l	T	A	10: 39,821,583	V692E	probably benign	Het
Robo4	T	C	9: 37,408,076		probably null	Het
Rps6kc1	T	C	1: 190,800,015	I597V	probably damaging	Het
Rtel1	T	A	2: 181,335,865		probably null	Het
Scn9a	A	G	2: 66,484,586	M1587T	probably benign	Het
Sec31b	T	A	19: 44,523,665	I597F	probably benign	Het
Skint5	T	C	4: 113,779,071	N650S	unknown	Het
Slc22a28	G	T	19: 8,130,202	S167*	probably null	Het
Slfn1	T	A	11: 83,121,142	M28K	probably damaging	Het
Smc6	T	C	12: 11,271,879		probably benign	Het
Sox8	T	C	17: 25,567,883	H282R	probably benign	Het
Syngr3	C	A	17: 24,686,440	V161L	probably benign	Het
Trak1	C	T	9: 121,454,359	S397F	probably damaging	Het
Uso1	C	T	5: 92,181,468	A405V	probably benign	Het
Uvrag	G	T	7: 99,065,820	Y190*	probably null	Het
Vps13d	A	T	4: 145,099,983	L1726Q	probably null	Het
Vwf	A	T	6: 125,603,457	Q556L	probably benign	Het
Wdr70	T	A	15: 8,035,844	M246L	probably benign	Het
Yipf3	T	C	17: 46,251,446	F285S	probably damaging	Het
Zdhhc13	G	A	7: 48,826,873	G579R	probably damaging	Het
Zdhhc18	G	C	4: 133,627,297	F125L	probably benign	Het

Other mutations in Cep63

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01598:Cep63	APN	9	102590458	missense	possibly damaging	0.88
IGL02378:Cep63	APN	9	102596115	splice site	probably benign
IGL02707:Cep63	APN	9	102586981	missense	probably damaging	1.00
IGL03273:Cep63	APN	9	102602467	missense	probably benign	0.13
R0355:Cep63	UTSW	9	102623560	missense	probably benign
R0847:Cep63	UTSW	9	102588758	missense	probably benign	0.12
R1276:Cep63	UTSW	9	102588900	missense	possibly damaging	0.77
R1654:Cep63	UTSW	9	102586913	missense	possibly damaging	0.87
R1730:Cep63	UTSW	9	102618867	missense	possibly damaging	0.93
R1982:Cep63	UTSW	9	102602880	missense	probably damaging	0.99
R2359:Cep63	UTSW	9	102594564	missense	possibly damaging	0.95
R2890:Cep63	UTSW	9	102618827	missense	probably damaging	0.99
R3082:Cep63	UTSW	9	102602497	missense	probably benign	0.00
R4725:Cep63	UTSW	9	102590556	intron	probably benign
R4761:Cep63	UTSW	9	102587041	intron	probably benign
R5200:Cep63	UTSW	9	102598188	missense	probably benign	0.22
R5538:Cep63	UTSW	9	102588793	nonsense	probably null
R6463:Cep63	UTSW	9	102596155	missense	probably benign
R6887:Cep63	UTSW	9	102625927	intron	probably benign
R7854:Cep63	UTSW	9	102602998	missense	probably damaging	1.00
R8206:Cep63	UTSW	9	102621271	intron	probably benign
R8465:Cep63	UTSW	9	102613377	missense	probably benign	0.31
R9015:Cep63	UTSW	9	102618912	missense	probably damaging	1.00
R9063:Cep63	UTSW	9	102619028	missense	unknown
R9327:Cep63	UTSW	9	102590524	missense	probably benign	0.05
R9463:Cep63	UTSW	9	102598183	missense	probably benign
R9542:Cep63	UTSW	9	102607334	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- TACAGCTATCAGGAGCTGAGCCAC -3'
(R):5'- AGGTTAGACACTGTACTCCACGGG -3'

Sequencing Primer
(F):5'- AGTCATATTGGTTCCCATCAGG -3'
(R):5'- TGTACTCCACGGGTCCTGAG -3'

Posted On

2014-03-14