Incidental Mutation 'R1576:Sstr5'
ID171189
Institutional Source Beutler Lab
Gene Symbol Sstr5
Ensembl Gene ENSMUSG00000050824
Gene Namesomatostatin receptor 5
SynonymsSmstr5, sst5
MMRRC Submission 039614-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R1576 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25489875-25497288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25491298 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 319 (C319Y)
Ref Sequence ENSEMBL: ENSMUSP00000128787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051864] [ENSMUST00000165183]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051864
AA Change: C319Y

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000051085
Gene: ENSMUSG00000050824
AA Change: C319Y

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:7TM_GPCR_Srv 44 320 1.3e-9 PFAM
Pfam:7TM_GPCR_Srx 45 317 5.5e-10 PFAM
Pfam:7TM_GPCR_Srsx 48 318 1.3e-19 PFAM
Pfam:7tm_1 54 303 3.1e-64 PFAM
Pfam:7TM_GPCR_Srw 195 321 1e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165183
AA Change: C319Y

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128787
Gene: ENSMUSG00000050824
AA Change: C319Y

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:7TM_GPCR_Srv 44 320 1.9e-9 PFAM
Pfam:7TM_GPCR_Srx 45 317 3.5e-10 PFAM
Pfam:7TM_GPCR_Srsx 48 318 1.3e-19 PFAM
Pfam:7tm_1 54 303 1.9e-71 PFAM
Pfam:7TM_GPCR_Srw 195 321 1e-8 PFAM
Meta Mutation Damage Score 0.5489 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Somatostatin and its related peptide cortistatin exert multiple biological actions on normal and tumoral tissue targets by interacting with somatostatin receptors (SSTRs). The protein encoded by this gene is one of the SSTRs, which is a multi-pass membrane protein and belongs to the G-protein coupled receptor 1 family. The activity of this receptor is mediated by G proteins which inhibit adenylyl cyclase, and different regions of this receptor molecule are required for the activation of different signaling pathways. A mutation in this gene results in somatostatin analog resistance. Alternatively spliced transcript variants have been identified in this gene.[provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygotes for one null allele display decreased numbers of insulin positive cells in the pancreas. Homozygotes for a second null allele have normal pancreatic islet morphology but increased insulin secretion, decreased blood insulin and glucose levels,and improved glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 G A 8: 22,808,467 probably benign Het
Apol11a T A 15: 77,516,931 I206N probably damaging Het
Arfgap3 A G 15: 83,313,563 S331P possibly damaging Het
Arhgef16 A C 4: 154,291,312 L75R probably damaging Het
Cfi T C 3: 129,873,050 V474A probably damaging Het
Dhx8 T C 11: 101,752,319 V739A probably damaging Het
Dpy19l2 T A 9: 24,584,502 H640L probably benign Het
Eif4g3 T A 4: 138,096,870 M57K probably damaging Het
Emilin2 A G 17: 71,255,117 probably null Het
Epc1 T C 18: 6,452,366 E281G possibly damaging Het
Fancd2 G T 6: 113,578,405 S1125I probably damaging Het
Fh1 G A 1: 175,607,819 P366L probably null Het
Gata3 A T 2: 9,863,196 S316T probably damaging Het
Hmcn1 A T 1: 150,657,241 S3064T possibly damaging Het
Inpp5d A T 1: 87,669,685 T193S probably benign Het
Inpp5d A T 1: 87,681,558 I277F probably damaging Het
Itga5 T C 15: 103,351,617 D616G probably damaging Het
Jade1 T A 3: 41,591,807 V89E probably damaging Het
Lamb2 T C 9: 108,480,307 S81P probably damaging Het
Lrrc19 G A 4: 94,639,353 P207L probably damaging Het
Maea A G 5: 33,362,696 D147G probably damaging Het
Muc6 T A 7: 141,634,524 E2767V possibly damaging Het
Myom2 A G 8: 15,084,556 Y453C probably damaging Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Nap1l1 A G 10: 111,494,820 D362G probably damaging Het
Nap1l4 C T 7: 143,538,216 probably null Het
Nudt21 A C 8: 94,028,833 probably null Het
Nufip1 A G 14: 76,134,870 N475D probably benign Het
Pcdhb8 A G 18: 37,356,703 D478G probably damaging Het
Pla2g4d A G 2: 120,284,167 S28P probably damaging Het
Polr2j C A 5: 136,120,028 N29K probably damaging Het
Ppp2r2a A G 14: 67,038,869 probably benign Het
Ptprk A G 10: 28,551,651 D742G probably damaging Het
Pum2 A G 12: 8,713,524 D227G probably benign Het
Rfxank C A 8: 70,134,303 R221L possibly damaging Het
Shank3 C A 15: 89,503,663 Q317K probably benign Het
Slc22a17 A G 14: 54,907,990 V460A probably damaging Het
Slc39a11 G T 11: 113,559,535 D41E probably damaging Het
Spag17 T C 3: 99,939,363 S68P possibly damaging Het
Stk17b G T 1: 53,757,590 D339E probably damaging Het
Tagln2 A G 1: 172,505,221 D25G probably benign Het
Ttn C T 2: 76,794,850 V13417I probably benign Het
Vps50 A G 6: 3,545,568 E334G possibly damaging Het
Zfp316 T C 5: 143,264,094 E138G unknown Het
Zfp879 T A 11: 50,833,549 T227S probably benign Het
Other mutations in Sstr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01532:Sstr5 APN 17 25491331 missense probably damaging 1.00
IGL01738:Sstr5 APN 17 25491610 missense probably damaging 1.00
IGL02212:Sstr5 APN 17 25491673 missense possibly damaging 0.93
IGL03098:Sstr5 UTSW 17 25491277 missense probably benign 0.00
R0402:Sstr5 UTSW 17 25492034 missense probably benign 0.15
R2354:Sstr5 UTSW 17 25491901 missense probably benign 0.29
R4392:Sstr5 UTSW 17 25491224 missense probably benign
R5339:Sstr5 UTSW 17 25491199 missense probably benign 0.00
R5469:Sstr5 UTSW 17 25492069 missense probably damaging 1.00
R5865:Sstr5 UTSW 17 25491244 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TTCACACTGCCACCAAGAGGAGTC -3'
(R):5'- ACATCGTCAACCTGGCCTTCAC -3'

Sequencing Primer
(F):5'- GAGTGCATCTCAGCAAACTCTC -3'
(R):5'- TTCACGCTACCCGAGGAG -3'
Posted On2014-04-13