Mutagenetix > Incidental Mutation

Incidental Mutation 'R1568:Clca2'

175407

Institutional Source

Beutler Lab

Gene Symbol

Clca2

Ensembl Gene

ENSMUSG00000036960

Gene Name

chloride channel accessory 2

Synonyms

Clca5

MMRRC Submission

039607-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1568 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

145070263-145099443 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 145075649 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 711 (Y711*)

Ref Sequence

ENSEMBL: ENSMUSP00000036029 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040465] [ENSMUST00000198993]

AlphaFold

Q8BG22

Predicted Effect

probably null
Transcript: ENSMUST00000040465
AA Change: Y711*

SMART Domains

Protein: ENSMUSP00000036029
Gene: ENSMUSG00000036960
AA Change: Y711*

Domain	Start	End	E-Value	Type
low complexity region	15	29	N/A	INTRINSIC
VWA	309	485	3.55e-5	SMART
low complexity region	739	754	N/A	INTRINSIC
Blast:FN3	765	875	5e-21	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000198993

SMART Domains

Protein: ENSMUSP00000143161
Gene: ENSMUSG00000036960

Domain	Start	End	E-Value	Type
Pfam:CLCA_N	7	265	1.7e-121	PFAM
VWA	309	485	2.2e-7	SMART
Pfam:DUF1973	494	674	7.8e-75	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.8%
20x: 90.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the calcium-activated chloride channel regulator (CLCR) family of proteins. Members of this family regulate the transport of chloride across the plasma membrane. Expression of this gene is upregulated by the tumor suppressor protein p53 in response to DNA damage. Mice lacking a functional copy of this gene exhibit increased liver weight and hepatocyte hypertrophy. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit increases in liver weight to body weight ratio and hepatocyte hypertrophy; one incidence of multifocal hepatic necrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	T	C	11: 23,589,971	K48E	probably damaging	Het
4931408C20Rik	T	C	1: 26,685,869	T77A	probably benign	Het
Adam18	T	G	8: 24,647,783		probably null	Het
Adgb	A	T	10: 10,442,665	Y138*	probably null	Het
Adra1d	T	C	2: 131,546,172	R488G	possibly damaging	Het
Ahnak	G	A	19: 9,002,375	G341E	probably damaging	Het
Ankmy1	T	C	1: 92,881,116	D690G	probably damaging	Het
Arhgef38	C	T	3: 133,132,464	E21K	probably damaging	Het
Atp8b2	T	C	3: 89,949,848	M402V	probably damaging	Het
Atp8b4	G	T	2: 126,325,394	H1062N	probably benign	Het
Bdnf	A	G	2: 109,723,794	H131R	probably damaging	Het
Cblb	C	T	16: 52,135,829	T265M	probably damaging	Het
Cenpe	T	A	3: 135,239,758	M1011K	probably benign	Het
Clca4a	A	G	3: 144,952,929	Y842H	probably benign	Het
Clspn	T	A	4: 126,581,517	M1021K	probably benign	Het
Cpne8	G	T	15: 90,619,642	R107S	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Dna2	C	T	10: 62,949,187	R28W	probably benign	Het
Dnah5	T	A	15: 28,409,177	N3580K	probably damaging	Het
Dsp	T	C	13: 38,175,147	I298T	probably damaging	Het
Dync2h1	T	C	9: 7,157,553	K858R	probably null	Het
Fasn	A	T	11: 120,813,249	V1448E	possibly damaging	Het
Ghdc	A	G	11: 100,768,505	I322T	probably benign	Het
Gins2	T	C	8: 120,582,200	D105G	probably damaging	Het
Insr	A	T	8: 3,165,576	D975E	probably benign	Het
Klrc3	T	C	6: 129,639,547	D169G	probably benign	Het
Krt76	T	A	15: 101,885,008	S532C	unknown	Het
Lamp3	A	T	16: 19,673,525	M323K	probably damaging	Het
Lgmn	T	C	12: 102,394,609	I423M	possibly damaging	Het
Lpgat1	A	T	1: 191,776,426	T359S	possibly damaging	Het
Lrguk	T	A	6: 34,086,438	I466N	probably damaging	Het
Magi3	A	C	3: 104,089,527	M234R	probably benign	Het
Myh14	G	A	7: 44,611,698	R1042*	probably null	Het
Nfia	T	G	4: 98,111,224	Y378D	possibly damaging	Het
Npffr1	T	A	10: 61,626,233	S383T	possibly damaging	Het
Olfr1308	C	A	2: 111,960,240	V278F	probably benign	Het
Olfr1410	T	C	1: 92,607,954	L39P	probably damaging	Het
Olfr1466	C	A	19: 13,342,175	P139Q	probably benign	Het
Olfr658	T	A	7: 104,644,770	I199F	probably benign	Het
Osr1	G	A	12: 9,579,798		probably null	Het
Pde4b	A	C	4: 102,597,699	R375S	probably damaging	Het
Pde8a	A	G	7: 81,292,263	E150G	probably damaging	Het
Pkhd1l1	A	T	15: 44,545,501		probably null	Het
Ppp3ca	A	G	3: 136,928,544	T422A	probably benign	Het
Proser1	T	C	3: 53,477,759	V354A	possibly damaging	Het
Rgs20	G	T	1: 5,020,827	R127S	probably benign	Het
Sec22a	T	C	16: 35,347,628	D171G	probably benign	Het
Secisbp2	A	G	13: 51,673,107	E417G	possibly damaging	Het
Serpinb6b	T	C	13: 32,974,912	L32S	probably damaging	Het
Sf3b1	C	G	1: 55,019,395	E12Q	possibly damaging	Het
Slc39a10	A	T	1: 46,826,215	S487T	probably benign	Het
Slc6a1	G	T	6: 114,307,770	G263V	probably damaging	Het
Spag6	A	G	2: 18,733,114	D265G	probably benign	Het
Sybu	G	T	15: 44,718,832	S132*	probably null	Het
Virma	T	C	4: 11,528,776	S1288P	probably damaging	Het
Vmn1r229	T	A	17: 20,814,805	V104D	probably damaging	Het
Vmn1r238	T	C	18: 3,123,358	T19A	probably benign	Het
Vmn2r86	C	T	10: 130,453,141	V164I	probably benign	Het
Wfdc13	G	T	2: 164,686,934	A64S	probably damaging	Het
Zfp873	C	A	10: 82,060,279	H318Q	probably damaging	Het
Zyg11a	A	G	4: 108,183,646		probably null	Het

Other mutations in Clca2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Clca2	APN	3	145098813	missense	probably damaging	1.00
IGL01337:Clca2	APN	3	145095178	missense	probably damaging	1.00
IGL01389:Clca2	APN	3	145077868	critical splice donor site	probably null
IGL01595:Clca2	APN	3	145088007	missense	probably damaging	1.00
IGL01704:Clca2	APN	3	145095218	missense	probably benign	0.04
IGL02416:Clca2	APN	3	145085016	missense	probably benign	0.02
IGL02455:Clca2	APN	3	145081411	missense	probably benign	0.00
IGL02481:Clca2	APN	3	145084940	missense	possibly damaging	0.92
IGL02526:Clca2	APN	3	145088018	missense	probably benign	0.02
IGL02797:Clca2	APN	3	145081263	missense	probably benign	0.02
IGL03253:Clca2	APN	3	145071563	missense	probably benign	0.41
IGL03256:Clca2	APN	3	145086392	missense	possibly damaging	0.75
IGL03294:Clca2	APN	3	145097769	missense	probably damaging	1.00
3370:Clca2	UTSW	3	145077977	missense	probably damaging	1.00
R0479:Clca2	UTSW	3	145090849	missense	probably damaging	1.00
R0542:Clca2	UTSW	3	145075810	splice site	probably benign
R0629:Clca2	UTSW	3	145072239	missense	probably benign
R1488:Clca2	UTSW	3	145084164	missense	possibly damaging	0.49
R1523:Clca2	UTSW	3	145071644	nonsense	probably null
R1650:Clca2	UTSW	3	145092212	missense	probably damaging	1.00
R1771:Clca2	UTSW	3	145081410	missense	probably benign	0.12
R2101:Clca2	UTSW	3	145077938	missense	probably damaging	0.99
R2242:Clca2	UTSW	3	145090790	missense	probably damaging	0.98
R3751:Clca2	UTSW	3	145071455	missense	probably benign	0.04
R4496:Clca2	UTSW	3	145092165	missense	possibly damaging	0.94
R4962:Clca2	UTSW	3	145077879	missense	probably damaging	1.00
R5344:Clca2	UTSW	3	145087942	missense	probably damaging	1.00
R5424:Clca2	UTSW	3	145084181	missense	probably damaging	0.99
R5931:Clca2	UTSW	3	145092125	missense	possibly damaging	0.88
R6181:Clca2	UTSW	3	145090708	nonsense	probably null
R6598:Clca2	UTSW	3	145086485	nonsense	probably null
R7167:Clca2	UTSW	3	145097784	missense	probably benign	0.40
R7229:Clca2	UTSW	3	145084108	missense	probably damaging	1.00
R7256:Clca2	UTSW	3	145090847	missense	probably damaging	0.99
R7365:Clca2	UTSW	3	145098784	missense	probably damaging	1.00
R7813:Clca2	UTSW	3	145084965	missense	probably benign	0.26
R8077:Clca2	UTSW	3	145071527	missense	possibly damaging	0.56
R8169:Clca2	UTSW	3	145077892	missense	probably damaging	1.00
R8290:Clca2	UTSW	3	145087958	missense	possibly damaging	0.93
R8300:Clca2	UTSW	3	145098931	missense	probably benign	0.00
R8350:Clca2	UTSW	3	145077907	missense	probably benign	0.19
R8854:Clca2	UTSW	3	145078091	missense	possibly damaging	0.94
R8876:Clca2	UTSW	3	145071599	missense	probably benign	0.00
R8887:Clca2	UTSW	3	145085049	nonsense	probably null
R9006:Clca2	UTSW	3	145078028	missense	probably damaging	0.99
R9093:Clca2	UTSW	3	145075720	missense	probably benign	0.20
R9190:Clca2	UTSW	3	145090838	missense	probably benign	0.00
R9209:Clca2	UTSW	3	145072244	missense	probably benign	0.00
R9501:Clca2	UTSW	3	145071561	nonsense	probably null
X0025:Clca2	UTSW	3	145086504	missense	possibly damaging	0.87
Z1177:Clca2	UTSW	3	145086451	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGCTACCTCTGAACAATAGCCACAAG -3'
(R):5'- TCTGACTCTATACACACAGGTGCAGAT -3'

Sequencing Primer
(F):5'- ttctctctctctctctctctctc -3'
(R):5'- TACACACAGGTGCAGATGTTATAAG -3'

Posted On

2014-04-24