Incidental Mutation 'R2044:Ltbp1'
ID221739
Institutional Source Beutler Lab
Gene Symbol Ltbp1
Ensembl Gene ENSMUSG00000001870
Gene Namelatent transforming growth factor beta binding protein 1
Synonymsb2b1000Clo, LTBP-1, 9430031G15Rik
MMRRC Submission 040051-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2044 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location75005568-75392512 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75276432 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 409 (Y409C)
Ref Sequence ENSEMBL: ENSMUSP00000116890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001927] [ENSMUST00000112514] [ENSMUST00000112516] [ENSMUST00000135447]
Predicted Effect probably damaging
Transcript: ENSMUST00000001927
AA Change: Y727C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001927
Gene: ENSMUSG00000001870
AA Change: Y727C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 34 49 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
low complexity region 94 109 N/A INTRINSIC
low complexity region 149 158 N/A INTRINSIC
EGF 184 213 9.27e-1 SMART
EGF 394 423 2.23e-3 SMART
Pfam:TB 559 601 2.4e-9 PFAM
EGF_CA 618 658 9.39e-11 SMART
Pfam:TB 680 720 1e-18 PFAM
low complexity region 839 849 N/A INTRINSIC
EGF_CA 865 906 5.83e-7 SMART
EGF_CA 907 948 6.39e-13 SMART
EGF_CA 949 989 4.25e-9 SMART
EGF_CA 990 1029 2.44e-9 SMART
EGF_CA 1030 1070 5.87e-12 SMART
EGF_CA 1071 1111 3.61e-12 SMART
EGF_CA 1112 1152 1.57e-12 SMART
EGF_CA 1153 1193 1.75e-10 SMART
EGF_CA 1194 1235 6.74e-12 SMART
EGF_CA 1236 1277 3.22e-9 SMART
EGF 1281 1320 2.16e1 SMART
Pfam:TB 1349 1391 5.6e-17 PFAM
EGF 1418 1457 1.14e0 SMART
EGF_CA 1458 1498 2.68e-6 SMART
Pfam:TB 1526 1567 4.2e-15 PFAM
EGF 1615 1652 1e-5 SMART
EGF_CA 1653 1697 5.11e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112514
SMART Domains Protein: ENSMUSP00000108133
Gene: ENSMUSG00000001870

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 76 105 2.23e-3 SMART
Pfam:TB 240 283 9.5e-13 PFAM
EGF_CA 300 340 9.39e-11 SMART
Pfam:TB 361 400 3.1e-17 PFAM
low complexity region 468 478 N/A INTRINSIC
EGF_CA 494 535 5.83e-7 SMART
EGF_CA 536 577 6.39e-13 SMART
EGF_CA 578 618 4.25e-9 SMART
EGF_CA 619 658 2.44e-9 SMART
EGF_CA 659 699 5.87e-12 SMART
EGF_CA 700 740 3.61e-12 SMART
EGF_CA 741 781 1.57e-12 SMART
EGF_CA 782 822 1.75e-10 SMART
EGF_CA 823 864 6.74e-12 SMART
EGF_CA 865 906 3.22e-9 SMART
EGF 910 949 2.16e1 SMART
Pfam:TB 977 1020 4.3e-20 PFAM
EGF 1047 1086 1.14e0 SMART
EGF_CA 1087 1127 2.68e-6 SMART
Pfam:TB 1154 1196 1.3e-17 PFAM
EGF 1244 1281 1e-5 SMART
EGF_CA 1282 1326 5.11e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112516
AA Change: Y409C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108135
Gene: ENSMUSG00000001870
AA Change: Y409C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 76 105 2.23e-3 SMART
Pfam:TB 240 283 9.9e-13 PFAM
EGF_CA 300 340 9.39e-11 SMART
Pfam:TB 361 402 7.6e-20 PFAM
low complexity region 521 531 N/A INTRINSIC
EGF_CA 547 588 5.83e-7 SMART
EGF_CA 589 630 6.39e-13 SMART
EGF_CA 631 671 4.25e-9 SMART
EGF_CA 672 711 2.44e-9 SMART
EGF_CA 712 752 5.87e-12 SMART
EGF_CA 753 793 3.61e-12 SMART
EGF_CA 794 834 1.57e-12 SMART
EGF_CA 835 875 1.75e-10 SMART
EGF_CA 876 917 6.74e-12 SMART
EGF_CA 918 959 3.22e-9 SMART
EGF 963 1002 2.16e1 SMART
Pfam:TB 1030 1073 4.5e-20 PFAM
EGF 1100 1139 1.14e0 SMART
EGF_CA 1140 1180 2.68e-6 SMART
Pfam:TB 1207 1249 1.4e-17 PFAM
EGF 1297 1334 1e-5 SMART
EGF_CA 1335 1379 5.11e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135447
AA Change: Y409C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116890
Gene: ENSMUSG00000001870
AA Change: Y409C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 76 105 1.1e-5 SMART
Pfam:TB 240 283 4.3e-10 PFAM
EGF_CA 300 340 4.4e-13 SMART
Pfam:TB 361 402 3.3e-17 PFAM
low complexity region 521 531 N/A INTRINSIC
EGF_CA 547 588 2.9e-9 SMART
EGF_CA 589 630 3e-15 SMART
EGF_CA 631 671 2.1e-11 SMART
EGF_CA 672 711 1.2e-11 SMART
EGF_CA 712 752 2.8e-14 SMART
EGF_CA 753 793 1.8e-14 SMART
EGF_CA 794 834 7.5e-15 SMART
EGF_CA 835 875 8.4e-13 SMART
EGF_CA 876 917 3.2e-14 SMART
EGF_CA 918 959 1.6e-11 SMART
Meta Mutation Damage Score 0.2341 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of latent TGF-beta binding proteins (LTBPs). The secretion and activation of TGF-betas is regulated by their association with latency-associated proteins and with latent TGF-beta binding proteins. The product of this gene targets latent complexes of transforming growth factor beta to the extracellular matrix, where the latent cytokine is subsequently activated by several different mechanisms. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and neonatal lethality associated with defects in the aortic arch and outflow tract. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 36,978,094 probably benign Het
Abhd15 A G 11: 77,518,338 T293A probably benign Het
Aldh1l1 C T 6: 90,562,665 P192L probably benign Het
Aldoart1 T G 4: 72,852,542 I10L probably benign Het
Ankhd1 G A 18: 36,645,113 G1653D probably benign Het
Ankk1 A C 9: 49,419,364 probably null Het
Astn1 A G 1: 158,600,502 T748A possibly damaging Het
Bmp7 C A 2: 172,939,915 R52L possibly damaging Het
Ccdc151 T G 9: 21,991,858 T419P possibly damaging Het
Ccdc33 G A 9: 58,031,112 P859S possibly damaging Het
Ccny A G 18: 9,449,644 S10P probably damaging Het
Cdc6 C A 11: 98,910,461 F179L probably benign Het
Cdc7 T A 5: 106,983,132 V491E probably benign Het
Cdh23 G T 10: 60,596,730 S138R possibly damaging Het
Cenpc1 T C 5: 86,037,755 H299R probably benign Het
Ciart A T 3: 95,878,701 M354K probably benign Het
Clasrp G T 7: 19,586,715 probably benign Het
Col4a3 G A 1: 82,696,319 G1132E unknown Het
Crebbp G A 16: 4,084,823 T2184I probably benign Het
Cyp2r1 A C 7: 114,550,405 M458R probably damaging Het
Cyp7a1 C A 4: 6,275,492 R27M probably null Het
Ddhd2 A G 8: 25,752,165 F116L probably damaging Het
Dgkd G A 1: 87,927,691 R685K probably benign Het
Dnah2 A G 11: 69,524,240 S223P probably benign Het
Exph5 A T 9: 53,372,679 R353S possibly damaging Het
F11 C A 8: 45,252,118 V129F probably benign Het
F830045P16Rik A T 2: 129,459,397 S454T possibly damaging Het
Fam124a T C 14: 62,587,207 I50T probably damaging Het
Fam20c T C 5: 138,756,227 probably null Het
Fam234b A G 6: 135,226,914 T405A probably benign Het
Fbxo18 C A 2: 11,762,970 V356L possibly damaging Het
Flywch1 G A 17: 23,762,313 Q132* probably null Het
Foxo6 T C 4: 120,286,969 D95G probably benign Het
Ggt5 T C 10: 75,604,087 F174S probably damaging Het
Gm7104 G A 12: 88,285,781 noncoding transcript Het
Gpr155 A G 2: 73,373,633 L279P probably damaging Het
H2-T23 A G 17: 36,032,191 L98P probably damaging Het
Heatr5a A G 12: 51,955,403 V250A probably benign Het
Heyl A T 4: 123,241,363 I50F probably damaging Het
Hist4h4 G C 6: 136,804,103 R93G possibly damaging Het
Ifitm10 A T 7: 142,356,034 S179R probably damaging Het
Isg15 A T 4: 156,199,792 I93N probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itga10 G A 3: 96,657,690 V985I probably benign Het
Kcnt2 T C 1: 140,375,154 I144T probably benign Het
Klk1 A C 7: 44,229,034 K104T possibly damaging Het
Lemd3 C A 10: 120,933,442 R654L probably damaging Het
Lmod1 A T 1: 135,364,387 M327L probably benign Het
Lonrf2 T C 1: 38,807,050 E347G probably benign Het
Mecom A T 3: 29,980,592 Y312N probably damaging Het
Mrgprb3 C T 7: 48,643,734 C23Y possibly damaging Het
Mut A G 17: 40,941,451 T295A probably benign Het
Nadk C A 4: 155,585,441 L194I probably damaging Het
Naxd A G 8: 11,509,510 I182V probably benign Het
Nbeal1 T A 1: 60,319,687 I1176K probably damaging Het
Nol4l C A 2: 153,529,521 R81L possibly damaging Het
Olfr1297 T A 2: 111,621,814 R87W probably benign Het
Olfr1411 G T 1: 92,596,969 R150L probably benign Het
Olfr957 A T 9: 39,511,378 M114K probably damaging Het
Pcdh18 A G 3: 49,754,940 V642A probably benign Het
Pdzk1 G A 3: 96,855,848 probably benign Het
Per3 C T 4: 151,033,938 V233I probably benign Het
Pisd G A 5: 32,764,796 P267S possibly damaging Het
Prm1 T A 16: 10,796,493 probably benign Het
Ptprj A G 2: 90,463,095 V548A probably damaging Het
Ranbp3 G A 17: 56,673,367 probably benign Het
Raver2 T A 4: 101,102,812 V163D probably damaging Het
Rbm14 A T 19: 4,803,877 I159N possibly damaging Het
Rfx6 G A 10: 51,718,126 V381I probably benign Het
Rhobtb1 T C 10: 69,272,863 probably benign Het
Rpl28-ps4 T A 6: 117,213,895 noncoding transcript Het
Rsph10b A G 5: 143,967,250 probably null Het
Rspo4 A G 2: 151,873,093 K217E unknown Het
Scgb2b27 G A 7: 34,013,285 A44V possibly damaging Het
Sec14l2 G A 11: 4,111,435 probably benign Het
Sec31b T C 19: 44,536,156 N101D probably benign Het
Sema6a A T 18: 47,306,429 C9* probably null Het
Sept5 A C 16: 18,623,012 L331R probably benign Het
Slc16a11 C A 11: 70,215,651 Y238* probably null Het
Slc25a12 T C 2: 71,312,548 T210A probably benign Het
Slc35f1 A T 10: 53,089,347 Y286F probably damaging Het
Szt2 A T 4: 118,376,448 L2225* probably null Het
Thap12 T C 7: 98,716,620 L665P probably damaging Het
Tpsb2 T A 17: 25,367,724 W237R probably damaging Het
Tyk2 T C 9: 21,120,341 D451G probably damaging Het
Ube2j1 T A 4: 33,049,696 N231K probably benign Het
Vmn1r225 A T 17: 20,502,590 T98S possibly damaging Het
Vmn1r87 A T 7: 13,131,821 S180T probably benign Het
Vmn2r6 A G 3: 64,537,841 V821A probably damaging Het
Zfp689 C A 7: 127,444,826 G211C probably damaging Het
Zfp827 A G 8: 79,076,236 D479G probably benign Het
Zfp995 A C 17: 21,880,594 F220V probably damaging Het
Other mutations in Ltbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ltbp1 APN 17 75225338 missense probably damaging 1.00
IGL00156:Ltbp1 APN 17 75385160 missense probably damaging 0.97
IGL00161:Ltbp1 APN 17 75310152 splice site probably benign
IGL00771:Ltbp1 APN 17 75362516 missense probably damaging 1.00
IGL00822:Ltbp1 APN 17 75151321 missense probably damaging 1.00
IGL01760:Ltbp1 APN 17 75227150 missense probably damaging 0.97
IGL01796:Ltbp1 APN 17 75227245 splice site probably benign
IGL01826:Ltbp1 APN 17 75292840 missense possibly damaging 0.67
IGL02372:Ltbp1 APN 17 75252406 missense probably damaging 0.99
IGL02792:Ltbp1 APN 17 75282994 missense probably damaging 1.00
IGL02862:Ltbp1 APN 17 75390471 missense probably damaging 1.00
IGL03095:Ltbp1 APN 17 75282418 missense possibly damaging 0.67
IGL03345:Ltbp1 APN 17 75066159 missense probably damaging 0.99
IGL03404:Ltbp1 APN 17 75225306 missense probably damaging 0.97
R0010:Ltbp1 UTSW 17 75363391 missense probably damaging 1.00
R0010:Ltbp1 UTSW 17 75363391 missense probably damaging 1.00
R0022:Ltbp1 UTSW 17 75364360 missense probably damaging 1.00
R0022:Ltbp1 UTSW 17 75364360 missense probably damaging 1.00
R0033:Ltbp1 UTSW 17 75276509 missense possibly damaging 0.66
R0033:Ltbp1 UTSW 17 75276509 missense possibly damaging 0.66
R0034:Ltbp1 UTSW 17 75047568 intron probably benign
R0068:Ltbp1 UTSW 17 75359409 missense probably damaging 1.00
R0068:Ltbp1 UTSW 17 75359409 missense probably damaging 1.00
R0467:Ltbp1 UTSW 17 75282429 critical splice donor site probably null
R0554:Ltbp1 UTSW 17 75225279 missense probably damaging 0.99
R0584:Ltbp1 UTSW 17 75363472 missense probably damaging 1.00
R0863:Ltbp1 UTSW 17 75252386 missense probably damaging 1.00
R0991:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1084:Ltbp1 UTSW 17 75359425 nonsense probably null
R1114:Ltbp1 UTSW 17 75360775 missense probably benign
R1177:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1179:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1195:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1195:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1195:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1245:Ltbp1 UTSW 17 75327194 splice site probably benign
R1246:Ltbp1 UTSW 17 75385161 nonsense probably null
R1258:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1259:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1260:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1262:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1265:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1267:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1269:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1272:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1411:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1579:Ltbp1 UTSW 17 75252367 missense probably benign 0.00
R1694:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1705:Ltbp1 UTSW 17 75385201 splice site probably null
R1716:Ltbp1 UTSW 17 75315024 missense probably benign 0.08
R1815:Ltbp1 UTSW 17 75252380 missense probably benign 0.00
R1932:Ltbp1 UTSW 17 75313034 missense probably benign 0.01
R1951:Ltbp1 UTSW 17 75151377 missense probably benign 0.00
R2118:Ltbp1 UTSW 17 75310159 missense possibly damaging 0.52
R2120:Ltbp1 UTSW 17 75310159 missense possibly damaging 0.52
R2121:Ltbp1 UTSW 17 75310159 missense possibly damaging 0.52
R2122:Ltbp1 UTSW 17 75310159 missense possibly damaging 0.52
R2171:Ltbp1 UTSW 17 75291317 missense probably damaging 0.99
R2237:Ltbp1 UTSW 17 75310163 missense probably benign 0.31
R2655:Ltbp1 UTSW 17 75005983 missense possibly damaging 0.76
R2941:Ltbp1 UTSW 17 75179093 missense probably damaging 1.00
R3177:Ltbp1 UTSW 17 75276480 missense possibly damaging 0.65
R3177:Ltbp1 UTSW 17 75359278 splice site probably null
R3277:Ltbp1 UTSW 17 75276480 missense possibly damaging 0.65
R3277:Ltbp1 UTSW 17 75359278 splice site probably null
R3797:Ltbp1 UTSW 17 75362630 missense probably damaging 1.00
R3861:Ltbp1 UTSW 17 75359338 missense possibly damaging 0.93
R3897:Ltbp1 UTSW 17 75274016 missense probably damaging 1.00
R4002:Ltbp1 UTSW 17 75310159 missense probably benign 0.09
R4057:Ltbp1 UTSW 17 75310194 missense probably damaging 1.00
R4261:Ltbp1 UTSW 17 75291367 nonsense probably null
R4375:Ltbp1 UTSW 17 75312997 missense probably damaging 1.00
R4458:Ltbp1 UTSW 17 75276507 missense possibly damaging 0.96
R4519:Ltbp1 UTSW 17 75364497 missense probably benign 0.14
R4529:Ltbp1 UTSW 17 75151360 missense probably benign 0.21
R4614:Ltbp1 UTSW 17 75289994 intron probably benign
R4724:Ltbp1 UTSW 17 75313008 missense probably damaging 0.99
R4756:Ltbp1 UTSW 17 75225204 missense probably damaging 1.00
R4907:Ltbp1 UTSW 17 75005904 missense probably benign
R4910:Ltbp1 UTSW 17 75327292 missense probably damaging 1.00
R4976:Ltbp1 UTSW 17 75321095 critical splice donor site probably null
R5011:Ltbp1 UTSW 17 75066157 missense probably damaging 0.99
R5047:Ltbp1 UTSW 17 75292886 splice site probably benign
R5259:Ltbp1 UTSW 17 75363362 missense probably benign 0.03
R5438:Ltbp1 UTSW 17 75291326 missense probably damaging 0.98
R5583:Ltbp1 UTSW 17 75291330 missense probably benign 0.00
R5757:Ltbp1 UTSW 17 75273949 synonymous probably null
R5950:Ltbp1 UTSW 17 75273870 missense probably damaging 1.00
R5976:Ltbp1 UTSW 17 75290083 missense probably damaging 1.00
R6267:Ltbp1 UTSW 17 75005989 missense possibly damaging 0.70
R6383:Ltbp1 UTSW 17 75359457 missense probably damaging 0.99
R6400:Ltbp1 UTSW 17 75151402 missense possibly damaging 0.62
R6861:Ltbp1 UTSW 17 75227192 missense possibly damaging 0.76
R6880:Ltbp1 UTSW 17 75321049 missense possibly damaging 0.77
R7168:Ltbp1 UTSW 17 75291366 missense probably damaging 1.00
R7198:Ltbp1 UTSW 17 75226967 missense possibly damaging 0.94
R7260:Ltbp1 UTSW 17 75066144 missense probably benign 0.01
R7262:Ltbp1 UTSW 17 75364368 missense probably damaging 1.00
R7340:Ltbp1 UTSW 17 75327228 nonsense probably null
R7443:Ltbp1 UTSW 17 75364437 missense probably damaging 1.00
R7510:Ltbp1 UTSW 17 75352717 missense probably damaging 1.00
R7676:Ltbp1 UTSW 17 75291297 missense possibly damaging 0.58
R7717:Ltbp1 UTSW 17 75290078 missense possibly damaging 0.90
R7720:Ltbp1 UTSW 17 75385124 missense probably damaging 1.00
X0001:Ltbp1 UTSW 17 75227178 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CTACATAGTGGCATATCGGCTAC -3'
(R):5'- GTCTGGCTAGAACCCACATC -3'

Sequencing Primer
(F):5'- GCAATTTGCTTACATTTTGCATCTG -3'
(R):5'- AAGCTCACCTTCGGGCTC -3'
Posted On2014-08-25