Mutagenetix > Incidental Mutation

Incidental Mutation 'R1997:Ankrd12'

224468

Institutional Source

Beutler Lab

Gene Symbol

Ankrd12

Ensembl Gene

ENSMUSG00000034647

Gene Name

ankyrin repeat domain 12

Synonyms

2900001A12Rik, GAC-1, ANCO-2

MMRRC Submission

040007-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.435) question?

Stock #

R1997 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65967501-66077089 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 65984884 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1185 (S1185P)

Ref Sequence

ENSEMBL: ENSMUSP00000039035 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038116] [ENSMUST00000150766]

AlphaFold

G5E893

Predicted Effect

probably damaging
Transcript: ENSMUST00000038116
AA Change: S1185P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000039035
Gene: ENSMUSG00000034647
AA Change: S1185P

Domain	Start	End	E-Value	Type
low complexity region	102	119	N/A	INTRINSIC
ANK	184	213	8.78e-6	SMART
ANK	217	246	1.76e-5	SMART
ANK	250	279	7.64e-6	SMART
low complexity region	292	300	N/A	INTRINSIC
low complexity region	358	369	N/A	INTRINSIC
low complexity region	403	416	N/A	INTRINSIC
coiled coil region	459	497	N/A	INTRINSIC
coiled coil region	639	676	N/A	INTRINSIC
coiled coil region	725	752	N/A	INTRINSIC
low complexity region	824	844	N/A	INTRINSIC
low complexity region	933	951	N/A	INTRINSIC
low complexity region	999	1018	N/A	INTRINSIC
low complexity region	1079	1090	N/A	INTRINSIC
low complexity region	1182	1197	N/A	INTRINSIC
low complexity region	1771	1783	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146090

Predicted Effect

probably benign
Transcript: ENSMUST00000150766

SMART Domains

Protein: ENSMUSP00000114237
Gene: ENSMUSG00000034647

Domain	Start	End	E-Value	Type
low complexity region	78	98	N/A	INTRINSIC
ANK	161	190	8.78e-6	SMART
ANK	194	223	1.76e-5	SMART
ANK	227	256	7.64e-6	SMART
low complexity region	269	277	N/A	INTRINSIC
low complexity region	335	346	N/A	INTRINSIC
low complexity region	380	393	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ankyrin repeats-containing cofactor family. These proteins may inhibit the transcriptional activity of nuclear receptors through the recruitment of histone deacetylases. The encoded protein interacts with p160 coactivators and also represses transcription mediated by the coactivator alteration/deficiency in activation 3 (ADA3). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	A	T	6: 48,932,429	Q536L	probably damaging	Het
3425401B19Rik	A	G	14: 32,660,048	F1320S	possibly damaging	Het
Aaas	C	T	15: 102,340,059	V241I	probably benign	Het
Abca17	A	G	17: 24,285,726	I1233T	probably benign	Het
Acin1	T	C	14: 54,646,699		probably null	Het
Acly	A	T	11: 100,519,151	I185N	probably damaging	Het
Adamts16	T	C	13: 70,753,267	D897G	probably benign	Het
Allc	A	C	12: 28,563,483	D153E	probably benign	Het
Ap1g2	T	C	14: 55,102,378	E448G	probably benign	Het
Atg9a	A	T	1: 75,189,626	V50D	probably benign	Het
Bace2	A	T	16: 97,415,089	D294V	possibly damaging	Het
Camsap2	T	C	1: 136,271,545	K708E	probably damaging	Het
Card10	G	A	15: 78,793,975	R358C	probably damaging	Het
Ccdc81	A	T	7: 89,898,063	V39E	probably damaging	Het
Cdh7	A	T	1: 110,048,938	D111V	probably damaging	Het
Cercam	C	A	2: 29,872,923	T223K	probably benign	Het
Cog5	A	G	12: 31,660,849	H76R	possibly damaging	Het
Col28a1	A	T	6: 7,999,644	N1024K	probably benign	Het
Csrnp3	A	T	2: 65,949,102	N41Y	probably damaging	Het
Cyp2t4	G	A	7: 27,157,613		probably null	Het
Dbn1	T	C	13: 55,482,441	H38R	probably damaging	Het
Dclre1b	A	G	3: 103,803,356	V287A	probably benign	Het
Dennd4c	A	G	4: 86,837,397	T1609A	probably benign	Het
Depdc5	T	A	5: 32,901,906		probably null	Het
Dhcr7	T	G	7: 143,847,430	D446E	probably damaging	Het
Dlx5	A	T	6: 6,879,680	M129K	possibly damaging	Het
Dnah11	C	G	12: 118,082,468	G1745A	possibly damaging	Het
Dnm3	T	C	1: 162,353,712	T133A	possibly damaging	Het
Eif3e	A	G	15: 43,265,609	L205P	probably damaging	Het
Fam166a	T	G	2: 25,220,205	L43R	probably damaging	Het
Fam91a1	A	G	15: 58,424,195		probably null	Het
Fank1	C	T	7: 133,862,225	T50I	probably damaging	Het
Fhod3	A	G	18: 25,090,416	T940A	possibly damaging	Het
Fkbp10	T	C	11: 100,416,015	F78L	probably damaging	Het
Gabbr2	A	C	4: 46,787,502	F387C	probably damaging	Het
Ggnbp2	A	T	11: 84,860,561	L138I	probably damaging	Het
Gm2832	T	A	14: 41,280,986		probably null	Het
Gm38394	A	G	1: 133,656,713	L962P	probably damaging	Het
Gm5084	T	A	13: 60,212,530		noncoding transcript	Het
Gm9979	T	C	13: 40,705,752		noncoding transcript	Het
Hepacam2	A	G	6: 3,487,241	S39P	probably damaging	Het
Hesx1	A	T	14: 27,001,383	N57Y	probably damaging	Het
Kcnh1	G	A	1: 192,276,935	V266I	probably damaging	Het
Kif24	T	C	4: 41,392,904	T1168A	possibly damaging	Het
Kng2	A	T	16: 23,024,876	F118I	possibly damaging	Het
Lig3	C	T	11: 82,787,666	P245S	probably benign	Het
Loxhd1	G	T	18: 77,295,769	W121C	probably damaging	Het
Ltn1	A	G	16: 87,381,637	V1568A	probably damaging	Het
Map3k4	A	T	17: 12,254,995		probably null	Het
Mcm10	C	T	2: 4,993,760	V790M	probably damaging	Het
Mia3	A	T	1: 183,344,286	F1223I	possibly damaging	Het
Mlec	C	A	5: 115,150,346	K150N	probably damaging	Het
Morn4	T	C	19: 42,076,538	K70R	possibly damaging	Het
Mphosph10	A	C	7: 64,387,447		probably null	Het
Myocd	G	A	11: 65,204,321	Q47*	probably null	Het
Nav2	T	A	7: 49,548,471	S1283T	probably benign	Het
Nbeal2	T	C	9: 110,632,198	H1599R	probably damaging	Het
Nek10	G	T	14: 14,827,003	G67V	probably benign	Het
Nlgn2	A	C	11: 69,828,050	V271G	probably damaging	Het
Olfr167	A	C	16: 19,515,042	V198G	probably damaging	Het
Olfr97	A	G	17: 37,231,632	V246A	probably damaging	Het
Pcolce2	A	T	9: 95,694,740	M355L	probably benign	Het
Per2	T	C	1: 91,440,859	E264G	probably damaging	Het
Phf2	A	G	13: 48,828,908	L113P	unknown	Het
Piwil2	A	G	14: 70,426,658	V14A	possibly damaging	Het
Plekha6	G	A	1: 133,263,818	A146T	probably benign	Het
Plxnb2	C	T	15: 89,158,768	V1473I	probably benign	Het
Pms2	T	C	5: 143,913,700	L111P	probably damaging	Het
Polg	A	G	7: 79,459,231	L533P	probably damaging	Het
Ppp1r12b	A	G	1: 134,846,355		probably benign	Het
Ppp2r1b	T	A	9: 50,867,371	M208K	possibly damaging	Het
Prdm5	A	G	6: 65,936,088	Y207C	probably damaging	Het
Prkar2b	A	G	12: 31,963,935	V314A	probably damaging	Het
Proser1	T	A	3: 53,478,871	S725T	probably benign	Het
Psg20	A	G	7: 18,682,610	F194L	probably benign	Het
Ptprz1	A	G	6: 23,050,497	I2255V	probably damaging	Het
Sardh	T	G	2: 27,244,397	T36P	probably damaging	Het
Sec23a	T	A	12: 59,002,007	I110L	probably benign	Het
Slc22a29	T	A	19: 8,217,798	I158L	probably benign	Het
Slc35c1	T	C	2: 92,454,639	D210G	probably benign	Het
Syde2	A	G	3: 145,998,991	N566S	probably benign	Het
Tcf20	G	A	15: 82,857,230	Q7*	probably null	Het
Terb2	T	A	2: 122,204,857	H186Q	possibly damaging	Het
Tet2	G	A	3: 133,486,589	Q695*	probably null	Het
Tnfaip1	T	C	11: 78,530,147	Y29C	probably damaging	Het
Traf3	A	G	12: 111,260,661	K328E	probably benign	Het
Uaca	A	G	9: 60,870,341	E668G	probably damaging	Het
Ube2o	T	A	11: 116,545,337	E326V	probably damaging	Het
Ubr1	C	T	2: 120,946,273		probably null	Het
Vmn1r19	T	A	6: 57,405,048	S195R	probably damaging	Het
Vmn1r213	T	G	13: 23,012,303	V352G	probably benign	Het
Vmn2r19	T	A	6: 123,315,921	D307E	probably damaging	Het
Wdfy3	T	C	5: 101,968,946	D76G	probably damaging	Het
Zan	A	T	5: 137,403,114	C4114*	probably null	Het
Zdhhc23	A	T	16: 43,978,942	C37S	probably damaging	Het
Zfp628	G	T	7: 4,918,832	G18W	probably damaging	Het
Zfp712	T	A	13: 67,042,050	K138*	probably null	Het
Zfp867	A	T	11: 59,463,591	V304D	probably damaging	Het
Zfp870	T	C	17: 32,884,053	T102A	possibly damaging	Het
Zmym5	G	A	14: 56,797,753	S286L	possibly damaging	Het

Other mutations in Ankrd12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Ankrd12	APN	17	65986174	missense	probably benign
IGL00555:Ankrd12	APN	17	65984976	missense	probably benign	0.09
IGL00790:Ankrd12	APN	17	65984180	missense	probably benign
IGL00808:Ankrd12	APN	17	65983965	missense	probably benign	0.03
IGL01355:Ankrd12	APN	17	65970340	splice site	probably benign
IGL01707:Ankrd12	APN	17	65984278	missense	probably damaging	0.98
IGL02045:Ankrd12	APN	17	65986249	missense	probably benign	0.17
IGL02125:Ankrd12	APN	17	65970144	utr 3 prime	probably benign
IGL02292:Ankrd12	APN	17	66042587	missense	probably damaging	0.99
IGL02376:Ankrd12	APN	17	66042529	intron	probably benign
IGL02435:Ankrd12	APN	17	65987156	missense	probably damaging	1.00
IGL02530:Ankrd12	APN	17	65984403	missense	probably benign	0.20
R0048:Ankrd12	UTSW	17	65984803	missense	probably damaging	1.00
R0048:Ankrd12	UTSW	17	65984803	missense	probably damaging	1.00
R0094:Ankrd12	UTSW	17	65970176	missense	probably damaging	1.00
R0195:Ankrd12	UTSW	17	66049948	splice site	probably null
R0227:Ankrd12	UTSW	17	65987227	missense	probably benign	0.00
R0363:Ankrd12	UTSW	17	65985681	missense	probably damaging	1.00
R0366:Ankrd12	UTSW	17	65984506	missense	possibly damaging	0.93
R0376:Ankrd12	UTSW	17	66053009	missense	probably damaging	0.98
R0470:Ankrd12	UTSW	17	65986134	missense	probably benign	0.00
R0480:Ankrd12	UTSW	17	66049828	missense	possibly damaging	0.47
R0538:Ankrd12	UTSW	17	66049852	missense	probably damaging	1.00
R0883:Ankrd12	UTSW	17	65985132	missense	probably benign	0.19
R1181:Ankrd12	UTSW	17	66042574	missense	probably benign	0.36
R1386:Ankrd12	UTSW	17	65983380	missense	possibly damaging	0.94
R1476:Ankrd12	UTSW	17	65986305	missense	probably damaging	0.99
R1574:Ankrd12	UTSW	17	65986274	missense	probably benign	0.08
R1574:Ankrd12	UTSW	17	65986274	missense	probably benign	0.08
R1602:Ankrd12	UTSW	17	65983688	nonsense	probably null
R1728:Ankrd12	UTSW	17	65984076	missense	probably benign	0.01
R1729:Ankrd12	UTSW	17	65984076	missense	probably benign	0.01
R1784:Ankrd12	UTSW	17	65984076	missense	probably benign	0.01
R1795:Ankrd12	UTSW	17	65986227	missense	possibly damaging	0.89
R1901:Ankrd12	UTSW	17	65986703	missense	possibly damaging	0.58
R1929:Ankrd12	UTSW	17	65986686	missense	possibly damaging	0.55
R1952:Ankrd12	UTSW	17	66031571	missense	probably damaging	0.98
R2207:Ankrd12	UTSW	17	66031574	splice site	probably null
R3612:Ankrd12	UTSW	17	65983547	missense	probably benign	0.01
R3768:Ankrd12	UTSW	17	65985720	missense	probably benign
R3909:Ankrd12	UTSW	17	65984005	missense	probably benign	0.05
R3945:Ankrd12	UTSW	17	65976103	missense	probably damaging	1.00
R4176:Ankrd12	UTSW	17	66027366	missense	probably damaging	1.00
R4461:Ankrd12	UTSW	17	65985937	splice site	probably null
R4628:Ankrd12	UTSW	17	65985994	missense	probably benign
R4726:Ankrd12	UTSW	17	65970324	missense	probably damaging	1.00
R4785:Ankrd12	UTSW	17	65982999	missense	probably damaging	1.00
R4828:Ankrd12	UTSW	17	65984637	missense	probably damaging	0.99
R4847:Ankrd12	UTSW	17	66024092	missense	probably benign	0.14
R4858:Ankrd12	UTSW	17	66031433	missense	probably damaging	1.00
R5344:Ankrd12	UTSW	17	66049848	missense	probably damaging	1.00
R5749:Ankrd12	UTSW	17	65986096	missense	probably benign	0.02
R7132:Ankrd12	UTSW	17	65983247	missense	probably benign
R7205:Ankrd12	UTSW	17	65985165	missense	probably damaging	1.00
R7379:Ankrd12	UTSW	17	65985247	nonsense	probably null
R7569:Ankrd12	UTSW	17	65982905	missense	probably damaging	1.00
R7570:Ankrd12	UTSW	17	65985360	missense	probably benign
R7783:Ankrd12	UTSW	17	66027250	critical splice donor site	probably null
R7790:Ankrd12	UTSW	17	65984230	missense	possibly damaging	0.71
R7808:Ankrd12	UTSW	17	65985653	missense	possibly damaging	0.94
R7834:Ankrd12	UTSW	17	65987352	missense	probably damaging	1.00
R7896:Ankrd12	UTSW	17	65985685	nonsense	probably null
R7985:Ankrd12	UTSW	17	65984196	missense	probably benign	0.00
R8251:Ankrd12	UTSW	17	65984559	missense	possibly damaging	0.94
R8304:Ankrd12	UTSW	17	65984547	missense	possibly damaging	0.86
R8379:Ankrd12	UTSW	17	65983944	missense	probably benign	0.01
R8441:Ankrd12	UTSW	17	66042551	missense	probably benign	0.21
R8485:Ankrd12	UTSW	17	65983716	missense	probably benign	0.00
R8507:Ankrd12	UTSW	17	65986909	nonsense	probably null
R8677:Ankrd12	UTSW	17	66024214	missense	probably damaging	1.00
R8790:Ankrd12	UTSW	17	65983158	missense	possibly damaging	0.89
R8888:Ankrd12	UTSW	17	66031573	critical splice acceptor site	probably null
R8944:Ankrd12	UTSW	17	65970200	nonsense	probably null
R8957:Ankrd12	UTSW	17	65984496	missense	probably benign
R9069:Ankrd12	UTSW	17	66049879	missense	probably benign
R9226:Ankrd12	UTSW	17	65985759	missense	probably damaging	0.99
R9275:Ankrd12	UTSW	17	66037604	missense	possibly damaging	0.81
R9278:Ankrd12	UTSW	17	66037604	missense	possibly damaging	0.81
R9339:Ankrd12	UTSW	17	65984413	missense	probably benign	0.00
R9400:Ankrd12	UTSW	17	65984880	missense	probably damaging	1.00
R9581:Ankrd12	UTSW	17	65983420	missense	probably damaging	0.99
Z1176:Ankrd12	UTSW	17	65970338	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CGGTCTGGTAGTTCAGTGAGAC -3'
(R):5'- TTACCAGGTCAAGAAGTTCAGAG -3'

Sequencing Primer
(F):5'- TAGTTCAGTGAGACCCTCCAG -3'
(R):5'- TCAAGAAGTTCAGAGTTGACTGATG -3'

Posted On

2014-08-25