Incidental Mutation 'R1997:Polg'
ID 224344
Institutional Source Beutler Lab
Gene Symbol Polg
Ensembl Gene ENSMUSG00000039176
Gene Name polymerase (DNA directed), gamma
Synonyms Polga, Pol gamma, mitochondrial DNA polymerase gamma, mitochondrial DNA polymerase-gamma, polymerase gamma
MMRRC Submission 040007-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1997 (G1)
Quality Score 218
Status Not validated
Chromosome 7
Chromosomal Location 79095979-79116110 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 79108979 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 533 (L533P)
Ref Sequence ENSEMBL: ENSMUSP00000073551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073889] [ENSMUST00000132048] [ENSMUST00000149444]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000073889
AA Change: L533P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073551
Gene: ENSMUSG00000039176
AA Change: L533P

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 131 149 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
POLAc 849 1123 2.23e-107 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127734
Predicted Effect probably benign
Transcript: ENSMUST00000132048
SMART Domains Protein: ENSMUSP00000143933
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
PDB:3IKM|D 53 203 2e-71 PDB
SCOP:d1qm9a1 76 122 3e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139597
Predicted Effect unknown
Transcript: ENSMUST00000139668
AA Change: L25P
SMART Domains Protein: ENSMUSP00000114414
Gene: ENSMUSG00000039176
AA Change: L25P

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
PDB:3IKM|D 13 236 1e-125 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139795
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142915
Predicted Effect unknown
Transcript: ENSMUST00000143672
AA Change: L52P
SMART Domains Protein: ENSMUSP00000122286
Gene: ENSMUSG00000039176
AA Change: L52P

DomainStartEndE-ValueType
PDB:3IKM|D 2 243 1e-117 PDB
SCOP:d1t7pa2 141 243 1e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201557
Predicted Effect probably benign
Transcript: ENSMUST00000149444
SMART Domains Protein: ENSMUSP00000119616
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
PDB:3IKM|D 53 490 N/A PDB
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial DNA polymerase is heterotrimeric, consisting of a homodimer of accessory subunits plus a catalytic subunit. The protein encoded by this gene is the catalytic subunit of mitochondrial DNA polymerase. The encoded protein contains a polyglutamine tract near its N-terminus that may be polymorphic. Defects in this gene are a cause of progressive external ophthalmoplegia with mitochondrial DNA deletions 1 (PEOA1), sensory ataxic neuropathy dysarthria and ophthalmoparesis (SANDO), Alpers-Huttenlocher syndrome (AHS), and mitochondrial neurogastrointestinal encephalopathy syndrome (MNGIE). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous proof-reading deficient mutants display reduced life spans and premature aging with weight loss, decreased subcutaneous fat, alopecia, kyphosis, osteoporosis, anemia, reduced fertility, and enlarged hearts. Homozygous null mice display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,382,005 (GRCm39) F1320S possibly damaging Het
Aaas C T 15: 102,248,494 (GRCm39) V241I probably benign Het
Abca17 A G 17: 24,504,700 (GRCm39) I1233T probably benign Het
Acin1 T C 14: 54,884,156 (GRCm39) probably null Het
Acly A T 11: 100,409,977 (GRCm39) I185N probably damaging Het
Adamts16 T C 13: 70,901,386 (GRCm39) D897G probably benign Het
Allc A C 12: 28,613,482 (GRCm39) D153E probably benign Het
Ankrd12 A G 17: 66,291,879 (GRCm39) S1185P probably damaging Het
Aoc1l2 A T 6: 48,909,363 (GRCm39) Q536L probably damaging Het
Ap1g2 T C 14: 55,339,835 (GRCm39) E448G probably benign Het
Atg9a A T 1: 75,166,270 (GRCm39) V50D probably benign Het
Bace2 A T 16: 97,216,289 (GRCm39) D294V possibly damaging Het
Camsap2 T C 1: 136,199,283 (GRCm39) K708E probably damaging Het
Card10 G A 15: 78,678,175 (GRCm39) R358C probably damaging Het
Ccdc81 A T 7: 89,547,271 (GRCm39) V39E probably damaging Het
Cdh20 A T 1: 109,976,668 (GRCm39) D111V probably damaging Het
Cercam C A 2: 29,762,935 (GRCm39) T223K probably benign Het
Cimip2a T G 2: 25,110,217 (GRCm39) L43R probably damaging Het
Cog5 A G 12: 31,710,848 (GRCm39) H76R possibly damaging Het
Col28a1 A T 6: 7,999,644 (GRCm39) N1024K probably benign Het
Csrnp3 A T 2: 65,779,446 (GRCm39) N41Y probably damaging Het
Cyp2t4 G A 7: 26,857,038 (GRCm39) probably null Het
Dbn1 T C 13: 55,630,254 (GRCm39) H38R probably damaging Het
Dclre1b A G 3: 103,710,672 (GRCm39) V287A probably benign Het
Dennd4c A G 4: 86,755,634 (GRCm39) T1609A probably benign Het
Depdc5 T A 5: 33,059,250 (GRCm39) probably null Het
Dhcr7 T G 7: 143,401,167 (GRCm39) D446E probably damaging Het
Dlx5 A T 6: 6,879,680 (GRCm39) M129K possibly damaging Het
Dnah11 C G 12: 118,046,203 (GRCm39) G1745A possibly damaging Het
Dnm3 T C 1: 162,181,281 (GRCm39) T133A possibly damaging Het
Eif3e A G 15: 43,129,005 (GRCm39) L205P probably damaging Het
Fam91a1 A G 15: 58,296,044 (GRCm39) probably null Het
Fank1 C T 7: 133,463,954 (GRCm39) T50I probably damaging Het
Fhod3 A G 18: 25,223,473 (GRCm39) T940A possibly damaging Het
Fkbp10 T C 11: 100,306,841 (GRCm39) F78L probably damaging Het
Gabbr2 A C 4: 46,787,502 (GRCm39) F387C probably damaging Het
Ggnbp2 A T 11: 84,751,387 (GRCm39) L138I probably damaging Het
Gm2832 T A 14: 41,002,943 (GRCm39) probably null Het
Gm5084 T A 13: 60,360,344 (GRCm39) noncoding transcript Het
Gm9979 T C 13: 40,859,228 (GRCm39) noncoding transcript Het
Hepacam2 A G 6: 3,487,241 (GRCm39) S39P probably damaging Het
Hesx1 A T 14: 26,723,340 (GRCm39) N57Y probably damaging Het
Kcnh1 G A 1: 191,959,243 (GRCm39) V266I probably damaging Het
Kif24 T C 4: 41,392,904 (GRCm39) T1168A possibly damaging Het
Kng2 A T 16: 22,843,626 (GRCm39) F118I possibly damaging Het
Lig3 C T 11: 82,678,492 (GRCm39) P245S probably benign Het
Loxhd1 G T 18: 77,383,465 (GRCm39) W121C probably damaging Het
Ltn1 A G 16: 87,178,525 (GRCm39) V1568A probably damaging Het
Map3k4 A T 17: 12,473,882 (GRCm39) probably null Het
Mcm10 C T 2: 4,998,571 (GRCm39) V790M probably damaging Het
Mia3 A T 1: 183,125,707 (GRCm39) F1223I possibly damaging Het
Mlec C A 5: 115,288,405 (GRCm39) K150N probably damaging Het
Morn4 T C 19: 42,064,977 (GRCm39) K70R possibly damaging Het
Mphosph10 A C 7: 64,037,195 (GRCm39) probably null Het
Myocd G A 11: 65,095,147 (GRCm39) Q47* probably null Het
Nav2 T A 7: 49,198,219 (GRCm39) S1283T probably benign Het
Nbeal2 T C 9: 110,461,266 (GRCm39) H1599R probably damaging Het
Nek10 G T 14: 14,827,003 (GRCm38) G67V probably benign Het
Nlgn2 A C 11: 69,718,876 (GRCm39) V271G probably damaging Het
Or1o2 A G 17: 37,542,523 (GRCm39) V246A probably damaging Het
Or2l5 A C 16: 19,333,792 (GRCm39) V198G probably damaging Het
Pcolce2 A T 9: 95,576,793 (GRCm39) M355L probably benign Het
Per2 T C 1: 91,368,581 (GRCm39) E264G probably damaging Het
Phf2 A G 13: 48,982,384 (GRCm39) L113P unknown Het
Piwil2 A G 14: 70,664,107 (GRCm39) V14A possibly damaging Het
Plekha6 G A 1: 133,191,556 (GRCm39) A146T probably benign Het
Plxnb2 C T 15: 89,042,971 (GRCm39) V1473I probably benign Het
Pms2 T C 5: 143,850,518 (GRCm39) L111P probably damaging Het
Ppp1r12b A G 1: 134,774,093 (GRCm39) probably benign Het
Ppp2r1b T A 9: 50,778,671 (GRCm39) M208K possibly damaging Het
Prdm5 A G 6: 65,913,072 (GRCm39) Y207C probably damaging Het
Prkar2b A G 12: 32,013,934 (GRCm39) V314A probably damaging Het
Proser1 T A 3: 53,386,292 (GRCm39) S725T probably benign Het
Psg20 A G 7: 18,416,535 (GRCm39) F194L probably benign Het
Ptprz1 A G 6: 23,050,496 (GRCm39) I2255V probably damaging Het
Sardh T G 2: 27,134,409 (GRCm39) T36P probably damaging Het
Sec23a T A 12: 59,048,793 (GRCm39) I110L probably benign Het
Slc22a29 T A 19: 8,195,162 (GRCm39) I158L probably benign Het
Slc35c1 T C 2: 92,284,984 (GRCm39) D210G probably benign Het
Syde2 A G 3: 145,704,746 (GRCm39) N566S probably benign Het
Tcf20 G A 15: 82,741,431 (GRCm39) Q7* probably null Het
Terb2 T A 2: 122,035,338 (GRCm39) H186Q possibly damaging Het
Tet2 G A 3: 133,192,350 (GRCm39) Q695* probably null Het
Tnfaip1 T C 11: 78,420,973 (GRCm39) Y29C probably damaging Het
Traf3 A G 12: 111,227,095 (GRCm39) K328E probably benign Het
Uaca A G 9: 60,777,623 (GRCm39) E668G probably damaging Het
Ube2o T A 11: 116,436,163 (GRCm39) E326V probably damaging Het
Ubr1 C T 2: 120,776,754 (GRCm39) probably null Het
Vmn1r19 T A 6: 57,382,033 (GRCm39) S195R probably damaging Het
Vmn1r213 T G 13: 23,196,473 (GRCm39) V352G probably benign Het
Vmn2r19 T A 6: 123,292,880 (GRCm39) D307E probably damaging Het
Wdfy3 T C 5: 102,116,812 (GRCm39) D76G probably damaging Het
Zan A T 5: 137,401,376 (GRCm39) C4114* probably null Het
Zbed6 A G 1: 133,584,451 (GRCm39) L962P probably damaging Het
Zdhhc23 A T 16: 43,799,305 (GRCm39) C37S probably damaging Het
Zfp628 G T 7: 4,921,831 (GRCm39) G18W probably damaging Het
Zfp712 T A 13: 67,190,114 (GRCm39) K138* probably null Het
Zfp867 A T 11: 59,354,417 (GRCm39) V304D probably damaging Het
Zfp870 T C 17: 33,103,027 (GRCm39) T102A possibly damaging Het
Zmym5 G A 14: 57,035,210 (GRCm39) S286L possibly damaging Het
Other mutations in Polg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Polg APN 7 79,101,673 (GRCm39) missense probably damaging 1.00
IGL00970:Polg APN 7 79,101,493 (GRCm39) missense probably benign 0.01
IGL01883:Polg APN 7 79,108,066 (GRCm39) missense probably damaging 1.00
IGL02124:Polg APN 7 79,109,485 (GRCm39) missense probably damaging 1.00
IGL02127:Polg APN 7 79,107,915 (GRCm39) unclassified probably benign
IGL02820:Polg APN 7 79,109,519 (GRCm39) missense possibly damaging 0.92
IGL03075:Polg APN 7 79,101,660 (GRCm39) missense probably damaging 1.00
IGL03180:Polg APN 7 79,101,601 (GRCm39) splice site probably benign
IGL03198:Polg APN 7 79,101,470 (GRCm39) missense probably damaging 1.00
IGL03222:Polg APN 7 79,104,404 (GRCm39) missense probably damaging 0.98
R0030:Polg UTSW 7 79,101,876 (GRCm39) missense probably damaging 1.00
R0064:Polg UTSW 7 79,111,632 (GRCm39) missense probably damaging 1.00
R0064:Polg UTSW 7 79,111,632 (GRCm39) missense probably damaging 1.00
R0416:Polg UTSW 7 79,101,988 (GRCm39) unclassified probably benign
R0522:Polg UTSW 7 79,109,899 (GRCm39) splice site probably benign
R0638:Polg UTSW 7 79,109,896 (GRCm39) splice site probably benign
R1263:Polg UTSW 7 79,109,534 (GRCm39) missense probably benign
R1831:Polg UTSW 7 79,109,518 (GRCm39) missense probably benign 0.41
R1873:Polg UTSW 7 79,106,241 (GRCm39) missense probably benign 0.04
R1906:Polg UTSW 7 79,110,070 (GRCm39) missense probably damaging 1.00
R2127:Polg UTSW 7 79,114,676 (GRCm39) missense probably damaging 1.00
R2155:Polg UTSW 7 79,111,468 (GRCm39) missense possibly damaging 0.94
R2156:Polg UTSW 7 79,111,468 (GRCm39) missense possibly damaging 0.94
R2173:Polg UTSW 7 79,105,341 (GRCm39) missense probably damaging 0.99
R3720:Polg UTSW 7 79,106,539 (GRCm39) nonsense probably null
R4082:Polg UTSW 7 79,114,576 (GRCm39) missense probably damaging 1.00
R4127:Polg UTSW 7 79,105,285 (GRCm39) missense probably damaging 1.00
R4510:Polg UTSW 7 79,105,270 (GRCm39) missense probably benign 0.01
R4511:Polg UTSW 7 79,105,270 (GRCm39) missense probably benign 0.01
R4571:Polg UTSW 7 79,110,127 (GRCm39) missense probably damaging 1.00
R4888:Polg UTSW 7 79,114,353 (GRCm39) missense probably damaging 1.00
R5008:Polg UTSW 7 79,109,822 (GRCm39) missense probably damaging 1.00
R5095:Polg UTSW 7 79,110,048 (GRCm39) missense possibly damaging 0.92
R5121:Polg UTSW 7 79,114,353 (GRCm39) missense probably damaging 1.00
R5139:Polg UTSW 7 79,099,773 (GRCm39) missense probably damaging 1.00
R5213:Polg UTSW 7 79,103,846 (GRCm39) missense probably damaging 1.00
R5285:Polg UTSW 7 79,114,973 (GRCm39) utr 5 prime probably benign
R5498:Polg UTSW 7 79,104,418 (GRCm39) missense probably damaging 1.00
R5714:Polg UTSW 7 79,101,739 (GRCm39) missense possibly damaging 0.53
R5940:Polg UTSW 7 79,103,819 (GRCm39) missense possibly damaging 0.95
R6146:Polg UTSW 7 79,100,260 (GRCm39) missense probably benign 0.02
R6754:Polg UTSW 7 79,109,584 (GRCm39) missense probably damaging 1.00
R6791:Polg UTSW 7 79,109,857 (GRCm39) missense probably benign 0.25
R6829:Polg UTSW 7 79,109,857 (GRCm39) missense probably benign 0.25
R6913:Polg UTSW 7 79,110,405 (GRCm39) missense probably damaging 0.97
R7644:Polg UTSW 7 79,101,416 (GRCm39) missense probably damaging 1.00
R7879:Polg UTSW 7 79,100,392 (GRCm39) missense probably benign 0.22
R8174:Polg UTSW 7 79,106,466 (GRCm39) missense probably benign 0.10
R8443:Polg UTSW 7 79,114,743 (GRCm39) missense probably benign
R9176:Polg UTSW 7 79,109,857 (GRCm39) missense probably benign 0.25
R9181:Polg UTSW 7 79,104,421 (GRCm39) missense probably damaging 1.00
R9303:Polg UTSW 7 79,105,860 (GRCm39) missense probably benign 0.02
R9305:Polg UTSW 7 79,105,860 (GRCm39) missense probably benign 0.02
R9323:Polg UTSW 7 79,114,786 (GRCm39) frame shift probably null
R9323:Polg UTSW 7 79,114,779 (GRCm39) frame shift probably null
R9331:Polg UTSW 7 79,108,148 (GRCm39) missense probably damaging 1.00
Z1176:Polg UTSW 7 79,103,489 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGAGTCAACACAAGTGAGC -3'
(R):5'- TCCCATGGATCAGGAAGGTG -3'

Sequencing Primer
(F):5'- TCAACACAAGTGAGCAGAAACG -3'
(R):5'- ACAGGGTGATCTCTGGGAC -3'
Posted On 2014-08-25