Incidental Mutation 'R2211:Pcbp4'
ID 239385
Institutional Source Beutler Lab
Gene Symbol Pcbp4
Ensembl Gene ENSMUSG00000023495
Gene Name poly(rC) binding protein 4
Synonyms AlphaCP-4, 1200003L19Rik
MMRRC Submission 040213-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.182) question?
Stock # R2211 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 106330490-106341211 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 106337933 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 74 (H74Q)
Ref Sequence ENSEMBL: ENSMUSP00000024260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024260] [ENSMUST00000164834] [ENSMUST00000185507] [ENSMUST00000185779] [ENSMUST00000185874] [ENSMUST00000190430] [ENSMUST00000189099] [ENSMUST00000216379] [ENSMUST00000214252] [ENSMUST00000213156] [ENSMUST00000188396] [ENSMUST00000215656] [ENSMUST00000190428]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000024260
AA Change: H74Q

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000024260
Gene: ENSMUSG00000023495
AA Change: H74Q

DomainStartEndE-ValueType
KH 16 84 4.15e-14 SMART
KH 100 171 1.47e-14 SMART
KH 240 310 3.24e-16 SMART
low complexity region 327 349 N/A INTRINSIC
low complexity region 364 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164834
SMART Domains Protein: ENSMUSP00000129055
Gene: ENSMUSG00000091735

DomainStartEndE-ValueType
Pfam:7tm_1 31 286 1.1e-16 PFAM
low complexity region 294 311 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185507
SMART Domains Protein: ENSMUSP00000140660
Gene: ENSMUSG00000023495

DomainStartEndE-ValueType
KH 2 65 2.4e-10 SMART
low complexity region 117 131 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185779
AA Change: H74Q

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000140629
Gene: ENSMUSG00000023495
AA Change: H74Q

DomainStartEndE-ValueType
KH 16 84 2.6e-16 SMART
KH 100 171 9.3e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185854
Predicted Effect probably benign
Transcript: ENSMUST00000185874
AA Change: H74Q

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000141057
Gene: ENSMUSG00000023495
AA Change: H74Q

DomainStartEndE-ValueType
KH 16 84 2.6e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186519
Predicted Effect probably benign
Transcript: ENSMUST00000190430
AA Change: H74Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000140485
Gene: ENSMUSG00000023495
AA Change: H74Q

DomainStartEndE-ValueType
KH 16 84 2.6e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189099
AA Change: H25Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139991
Gene: ENSMUSG00000023495
AA Change: H25Q

DomainStartEndE-ValueType
Pfam:KH_1 33 77 1.3e-9 PFAM
Pfam:KH_3 36 77 3.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190799
Predicted Effect probably benign
Transcript: ENSMUST00000216379
AA Change: H74Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000214252
AA Change: H74Q

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217405
Predicted Effect probably benign
Transcript: ENSMUST00000213156
Predicted Effect probably benign
Transcript: ENSMUST00000188396
SMART Domains Protein: ENSMUSP00000139771
Gene: ENSMUSG00000023495

DomainStartEndE-ValueType
Blast:KH 1 41 2e-19 BLAST
KH 61 122 1.7e-7 SMART
low complexity region 139 161 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215656
Predicted Effect probably benign
Transcript: ENSMUST00000190428
SMART Domains Protein: ENSMUSP00000139587
Gene: ENSMUSG00000023495

DomainStartEndE-ValueType
PDB:2JZX|A 1 33 1e-8 PDB
Blast:KH 30 80 3e-26 BLAST
KH 100 167 2e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213201
Predicted Effect probably benign
Transcript: ENSMUST00000213752
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KH-domain protein subfamily. Proteins of this subfamily, also referred to as alpha-CPs, bind to RNA with a specificity for C-rich pyrimidine regions. Alpha-CPs play important roles in post-transcriptional activities and have different cellular distributions. This gene is induced by the p53 tumor suppressor, and the encoded protein can suppress cell proliferation by inducing apoptosis and cell cycle arrest in G(2)-M. This gene's protein is found in the cytoplasm, yet it lacks the nuclear localization signals found in other subfamily members. Multiple alternatively spliced transcript variants have been described, but the full-length nature for only some has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous or heterozygous for a knock-out allele are reduced in body weight and prone to lung adenocarcinoma, B cell derived lymphoma and lung tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A G 8: 25,118,171 (GRCm39) S34P probably damaging Het
Adam23 T A 1: 63,612,288 (GRCm39) probably benign Het
Adcy10 A T 1: 165,345,781 (GRCm39) I277F probably damaging Het
Arfgef3 A T 10: 18,467,993 (GRCm39) S1736T possibly damaging Het
Arhgap21 A T 2: 20,886,451 (GRCm39) M242K possibly damaging Het
Arhgef18 T C 8: 3,437,680 (GRCm39) S268P possibly damaging Het
Astn1 A G 1: 158,484,876 (GRCm39) R4G probably benign Het
AU041133 G A 10: 81,986,755 (GRCm39) C135Y probably damaging Het
Cdc42bpb A G 12: 111,268,288 (GRCm39) V53A probably benign Het
Cdh23 T C 10: 60,301,783 (GRCm39) D428G possibly damaging Het
Cebpa T C 7: 34,819,891 (GRCm39) S350P probably damaging Het
Cftr A G 6: 18,214,279 (GRCm39) M152V probably null Het
Cpa4 A G 6: 30,583,649 (GRCm39) N255S possibly damaging Het
Ddx51 T A 5: 110,803,634 (GRCm39) D343E probably damaging Het
Dnah7a T C 1: 53,518,932 (GRCm39) I2942V probably benign Het
Dnajc1 G T 2: 18,397,286 (GRCm39) A9E probably damaging Het
Dpysl5 G A 5: 30,948,941 (GRCm39) D399N probably damaging Het
Edem3 A G 1: 151,680,453 (GRCm39) D526G possibly damaging Het
Emc10 G A 7: 44,142,616 (GRCm39) R109W probably damaging Het
Etaa1 G A 11: 17,902,686 (GRCm39) Q84* probably null Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fam149a G A 8: 45,794,046 (GRCm39) T674I probably damaging Het
Fam98a A G 17: 75,845,940 (GRCm39) probably null Het
Fat4 A G 3: 38,945,676 (GRCm39) N1523S possibly damaging Het
Fbxw10 A G 11: 62,758,361 (GRCm39) T529A probably damaging Het
Gzf1 C T 2: 148,526,870 (GRCm39) A447V probably damaging Het
Hap1 G A 11: 100,245,550 (GRCm39) T138M probably benign Het
Hic1 T A 11: 75,060,210 (GRCm39) R46W possibly damaging Het
Id4 T A 13: 48,415,278 (GRCm39) L102Q probably damaging Het
Il3ra T C 14: 14,355,029 (GRCm38) C271R probably benign Het
Ints4 T C 7: 97,158,957 (GRCm39) I443T possibly damaging Het
Lmln A G 16: 32,930,148 (GRCm39) E535G probably benign Het
Lrrtm4 A G 6: 79,999,623 (GRCm39) H345R probably benign Het
Ltbp3 T C 19: 5,803,990 (GRCm39) I834T possibly damaging Het
Mnd1 C A 3: 84,041,416 (GRCm39) C62F probably benign Het
Ms4a18 C A 19: 10,974,669 (GRCm39) V341L probably benign Het
Nbr1 T C 11: 101,458,090 (GRCm39) probably null Het
Nf1 T C 11: 79,334,890 (GRCm39) M914T probably benign Het
Notch3 T A 17: 32,366,952 (GRCm39) H861L probably benign Het
Nup58 A G 14: 60,470,089 (GRCm39) F341L probably damaging Het
Ogfod2 C A 5: 124,250,843 (GRCm39) probably null Het
Oit3 T C 10: 59,263,892 (GRCm39) D414G probably damaging Het
Or6c5c A T 10: 129,298,809 (GRCm39) K88M probably damaging Het
Or6c6c A G 10: 129,541,320 (GRCm39) H191R probably benign Het
Or8k32 T C 2: 86,368,857 (GRCm39) Y132C probably damaging Het
Or9q2 T A 19: 13,772,733 (GRCm39) M81L probably benign Het
Pals1 A T 12: 78,844,022 (GRCm39) K75N possibly damaging Het
Pip5k1b A T 19: 24,356,214 (GRCm39) D241E probably damaging Het
Plcb2 T C 2: 118,554,015 (GRCm39) D102G probably benign Het
Plekha5 G A 6: 140,471,587 (GRCm39) E4K possibly damaging Het
Ppargc1a A C 5: 51,631,601 (GRCm39) S343A possibly damaging Het
Ppwd1 G A 13: 104,343,650 (GRCm39) S585L probably benign Het
Rarg T C 15: 102,147,959 (GRCm39) N284S probably benign Het
Rnpepl1 C T 1: 92,844,102 (GRCm39) L278F probably damaging Het
Rp1 A C 1: 4,418,362 (GRCm39) S917A probably damaging Het
Rsf1 ATGGCG ATGGCGAGGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Rsph3b T C 17: 7,209,139 (GRCm39) S189G probably benign Het
Sec31b A T 19: 44,511,589 (GRCm39) L604Q probably damaging Het
Sema6b T A 17: 56,431,741 (GRCm39) I641F probably benign Het
Slc35f5 A T 1: 125,507,001 (GRCm39) I309F possibly damaging Het
Smarca4 A G 9: 21,597,325 (GRCm39) E1360G probably damaging Het
Spata31d1c T C 13: 65,183,753 (GRCm39) S432P probably benign Het
Spsb3 T C 17: 25,109,911 (GRCm39) probably null Het
Sptbn4 T C 7: 27,067,034 (GRCm39) D1960G probably damaging Het
Srgap1 A G 10: 121,689,645 (GRCm39) V345A possibly damaging Het
Tiam2 C A 17: 3,465,193 (GRCm39) C307* probably null Het
Trim43b T A 9: 88,967,302 (GRCm39) T444S possibly damaging Het
Trmt13 A G 3: 116,388,403 (GRCm39) I11T probably benign Het
Ylpm1 A T 12: 85,091,152 (GRCm39) R1073* probably null Het
Zfp524 T C 7: 5,020,918 (GRCm39) S149P probably damaging Het
Zfp777 T C 6: 48,020,819 (GRCm39) I312V possibly damaging Het
Other mutations in Pcbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Pcbp4 APN 9 106,340,448 (GRCm39) splice site probably null
IGL01484:Pcbp4 APN 9 106,337,848 (GRCm39) critical splice acceptor site probably null
R1688:Pcbp4 UTSW 9 106,338,533 (GRCm39) missense probably damaging 1.00
R3894:Pcbp4 UTSW 9 106,338,570 (GRCm39) missense possibly damaging 0.82
R4729:Pcbp4 UTSW 9 106,337,929 (GRCm39) missense probably damaging 1.00
R4884:Pcbp4 UTSW 9 106,339,301 (GRCm39) missense probably benign 0.03
R5007:Pcbp4 UTSW 9 106,339,292 (GRCm39) missense probably damaging 1.00
R5112:Pcbp4 UTSW 9 106,337,917 (GRCm39) missense probably damaging 1.00
R6050:Pcbp4 UTSW 9 106,339,422 (GRCm39) missense probably benign 0.41
R6747:Pcbp4 UTSW 9 106,337,847 (GRCm39) splice site probably null
R8381:Pcbp4 UTSW 9 106,338,488 (GRCm39) missense probably damaging 1.00
R8717:Pcbp4 UTSW 9 106,337,202 (GRCm39) critical splice acceptor site probably null
R9590:Pcbp4 UTSW 9 106,340,400 (GRCm39) missense possibly damaging 0.94
X0027:Pcbp4 UTSW 9 106,339,782 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCAGAAGAATGGCAGTTTC -3'
(R):5'- TCCCTCAAGAACTTTCCTGAAGAG -3'

Sequencing Primer
(F):5'- CCCAGAAGAATGGCAGTTTCTAGTC -3'
(R):5'- CTTTCCTGAAGAGGGAGAAGG -3'
Posted On 2014-10-15