Incidental Mutation 'R2228:Sppl2b'
ID 239867
Institutional Source Beutler Lab
Gene Symbol Sppl2b
Ensembl Gene ENSMUSG00000035206
Gene Name signal peptide peptidase like 2B
Synonyms 3110056O03Rik
MMRRC Submission 040229-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.878) question?
Stock # R2228 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 80691109-80704542 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 80701451 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 389 (V389M)
Ref Sequence ENSEMBL: ENSMUSP00000036289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035597] [ENSMUST00000220091]
AlphaFold Q3TD49
Predicted Effect probably damaging
Transcript: ENSMUST00000035597
AA Change: V389M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206
AA Change: V389M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
Pfam:PA 55 147 5.5e-14 PFAM
transmembrane domain 167 189 N/A INTRINSIC
PSN 210 485 2.16e-113 SMART
low complexity region 520 531 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218727
Predicted Effect probably benign
Transcript: ENSMUST00000218789
AA Change: V258M

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218812
Predicted Effect possibly damaging
Transcript: ENSMUST00000219951
AA Change: V134M

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219136
Predicted Effect probably benign
Transcript: ENSMUST00000220091
Predicted Effect probably benign
Transcript: ENSMUST00000219614
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal with no apparent defects in B cell and dendritic cell homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,559,935 (GRCm39) T242A probably benign Het
Adam24 A T 8: 41,133,404 (GRCm39) I291L probably benign Het
Adamts16 G A 13: 70,927,637 (GRCm39) probably benign Het
Adcy8 C A 15: 64,694,056 (GRCm39) R407L possibly damaging Het
Aldh3b2 C T 19: 4,031,133 (GRCm39) P461S probably benign Het
Araf T C X: 20,717,912 (GRCm39) F144L probably benign Het
Atp11b G T 3: 35,861,091 (GRCm39) D193Y probably damaging Het
Atp6v1b2 C A 8: 69,555,411 (GRCm39) probably null Het
Bclaf1 T A 10: 20,215,624 (GRCm39) probably benign Het
Cadps A G 14: 12,465,935 (GRCm38) Y987H probably benign Het
Capn6 T G X: 142,587,785 (GRCm39) T498P possibly damaging Het
Ccdc153 T A 9: 44,154,314 (GRCm39) L47Q probably damaging Het
Ccdc180 G T 4: 45,948,856 (GRCm39) probably null Het
Cep162 G T 9: 87,126,384 (GRCm39) T176K probably benign Het
Cpsf2 A G 12: 101,956,088 (GRCm39) D297G probably benign Het
Entpd8 T C 2: 24,975,028 (GRCm39) M453T probably damaging Het
Eprs1 T A 1: 185,099,734 (GRCm39) L18Q probably damaging Het
Fem1b G T 9: 62,704,020 (GRCm39) C413* probably null Het
Flrt1 T A 19: 7,072,723 (GRCm39) D608V probably damaging Het
Fstl5 C A 3: 76,389,659 (GRCm39) N285K probably damaging Het
Golga1 T C 2: 38,913,183 (GRCm39) D543G probably benign Het
Hivep2 A G 10: 14,004,107 (GRCm39) H235R probably damaging Het
Htr2c G C X: 145,977,186 (GRCm39) W325C probably damaging Het
Htr2c G T X: 145,977,188 (GRCm39) C326F probably damaging Het
Ifit1bl2 G T 19: 34,596,630 (GRCm39) L329M possibly damaging Het
Igsf9b T C 9: 27,244,792 (GRCm39) S920P probably damaging Het
Macroh2a1 C T 13: 56,232,075 (GRCm39) G235S probably damaging Het
Mcm8 T A 2: 132,662,041 (GRCm39) I125K possibly damaging Het
Micall1 C T 15: 79,014,036 (GRCm39) R644W probably damaging Het
Myo16 G A 8: 10,644,905 (GRCm39) D1746N possibly damaging Het
Myo9a A G 9: 59,801,463 (GRCm39) E1887G probably benign Het
Nbn A G 4: 15,970,904 (GRCm39) T296A probably benign Het
Nckap1l T C 15: 103,364,361 (GRCm39) probably null Het
Neb T C 2: 52,123,007 (GRCm39) R3734G probably benign Het
Nup93 C T 8: 95,030,819 (GRCm39) T305I probably benign Het
Or5bw2 A T 7: 6,573,802 (GRCm39) M271L probably benign Het
P2ry4 A G X: 99,637,553 (GRCm39) L115P probably damaging Het
Pmepa1 G A 2: 173,069,926 (GRCm39) R210W probably damaging Het
Ppp1r26 T C 2: 28,343,798 (GRCm39) F1143L possibly damaging Het
Ppp1r3c C A 19: 36,711,098 (GRCm39) R224L probably benign Het
Ptafr T G 4: 132,306,691 (GRCm39) I27R possibly damaging Het
Pwwp2b T C 7: 138,835,104 (GRCm39) C182R probably damaging Het
Reln A G 5: 22,192,076 (GRCm39) F1455L possibly damaging Het
Rufy1 C T 11: 50,288,611 (GRCm39) probably null Het
Samd9l T C 6: 3,376,910 (GRCm39) H117R probably benign Het
Sfxn4 C T 19: 60,839,458 (GRCm39) G200E probably damaging Het
Sipa1l3 T A 7: 29,077,364 (GRCm39) K803* probably null Het
Smim23 C A 11: 32,771,870 (GRCm39) Q65H probably damaging Het
Spata18 A T 5: 73,824,244 (GRCm39) I156L possibly damaging Het
Srbd1 T C 17: 86,292,651 (GRCm39) I973V probably damaging Het
Ssx2ip C T 3: 146,123,531 (GRCm39) P10L probably damaging Het
Taf2 A C 15: 54,928,042 (GRCm39) D120E possibly damaging Het
Tanc1 T C 2: 59,555,068 (GRCm39) L42S probably benign Het
Tex15 C A 8: 34,061,265 (GRCm39) H232N probably benign Het
Tg A T 15: 66,545,860 (GRCm39) Q194L probably damaging Het
Tnfrsf22 C T 7: 143,198,513 (GRCm39) probably null Het
Tro A T X: 149,438,477 (GRCm39) M60K probably benign Het
Ttc38 G A 15: 85,728,704 (GRCm39) V219I probably benign Het
U2af2 T C 7: 5,078,672 (GRCm39) I417T probably damaging Het
Ube2r2 C T 4: 41,174,044 (GRCm39) H61Y probably benign Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Vmn1r113 C T 7: 20,521,832 (GRCm39) S208F probably damaging Het
Wdr35 A G 12: 9,024,955 (GRCm39) K16E possibly damaging Het
Wwp1 A T 4: 19,641,745 (GRCm39) Y437N probably damaging Het
Zdhhc4 A C 5: 143,306,162 (GRCm39) W189G probably damaging Het
Zfp512 A T 5: 31,622,919 (GRCm39) K73N probably damaging Het
Other mutations in Sppl2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Sppl2b APN 10 80,699,928 (GRCm39) missense probably damaging 1.00
IGL01835:Sppl2b APN 10 80,701,175 (GRCm39) missense probably damaging 0.99
IGL01836:Sppl2b APN 10 80,697,220 (GRCm39) missense probably benign 0.00
IGL01964:Sppl2b APN 10 80,701,220 (GRCm39) critical splice donor site probably null
IGL02376:Sppl2b APN 10 80,703,432 (GRCm39) nonsense probably null
R1641:Sppl2b UTSW 10 80,700,965 (GRCm39) missense probably damaging 0.96
R3104:Sppl2b UTSW 10 80,703,325 (GRCm39) missense probably benign 0.00
R3106:Sppl2b UTSW 10 80,703,325 (GRCm39) missense probably benign 0.00
R4350:Sppl2b UTSW 10 80,698,560 (GRCm39) missense probably benign 0.12
R5146:Sppl2b UTSW 10 80,703,474 (GRCm39) makesense probably null
R5698:Sppl2b UTSW 10 80,701,879 (GRCm39) splice site probably null
R6969:Sppl2b UTSW 10 80,700,959 (GRCm39) missense probably damaging 1.00
R7649:Sppl2b UTSW 10 80,703,253 (GRCm39) missense probably benign 0.02
R8212:Sppl2b UTSW 10 80,701,193 (GRCm39) missense probably damaging 1.00
R8263:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8265:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8367:Sppl2b UTSW 10 80,699,025 (GRCm39) missense probably benign 0.02
R8398:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8398:Sppl2b UTSW 10 80,701,902 (GRCm39) frame shift probably null
R8400:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8480:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8481:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8505:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8817:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8818:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8832:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R9175:Sppl2b UTSW 10 80,698,807 (GRCm39) missense probably benign
R9624:Sppl2b UTSW 10 80,699,373 (GRCm39) missense probably benign 0.03
Z1176:Sppl2b UTSW 10 80,703,259 (GRCm39) missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- CCTTTCTTGTGCAGAGTGGC -3'
(R):5'- AGGTGTGGCCATACAATAGTCATG -3'

Sequencing Primer
(F):5'- ATCCACCCATGAGAAGGT -3'
(R):5'- ATAGTCATGCACTACCCGGGAG -3'
Posted On 2014-10-15