Incidental Mutation 'R2366:Col6a6'
ID 246339
Institutional Source Beutler Lab
Gene Symbol Col6a6
Ensembl Gene ENSMUSG00000043719
Gene Name collagen, type VI, alpha 6
Synonyms E330026B02Rik
MMRRC Submission 040347-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock # R2366 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 105687809-105828160 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 105755694 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 1457 (G1457V)
Ref Sequence ENSEMBL: ENSMUSP00000096040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098441] [ENSMUST00000166431]
AlphaFold Q8C6K9
Predicted Effect probably damaging
Transcript: ENSMUST00000098441
AA Change: G1457V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096040
Gene: ENSMUSG00000043719
AA Change: G1457V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 3.3e-9 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166431
AA Change: G1457V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125765
Gene: ENSMUSG00000043719
AA Change: G1457V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 9.3e-10 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Meta Mutation Damage Score 0.9115 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,753,635 I726N probably damaging Het
A430089I19Rik T C 5: 94,303,113 K385E probably benign Het
A630091E08Rik G A 7: 98,543,742 noncoding transcript Het
Adamts5 C T 16: 85,862,758 G882D probably damaging Het
Arl6ip6 T C 2: 53,192,367 V82A probably benign Het
Cd38 T G 5: 43,903,590 probably benign Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Cyp2d12 T A 15: 82,555,154 L3Q probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Drc1 A G 5: 30,366,550 *754W probably null Het
Erbin G A 13: 103,844,909 H503Y probably damaging Het
F3 G A 3: 121,732,545 probably null Het
Gps1 A C 11: 120,788,119 I404L probably damaging Het
Hc T C 2: 35,013,636 N1002S probably benign Het
Impg2 T C 16: 56,259,873 I571T probably benign Het
Knop1 C A 7: 118,852,528 V323F possibly damaging Het
Kntc1 C T 5: 123,781,192 L845F probably damaging Het
Lsm5 T C 6: 56,703,018 D53G probably damaging Het
Lzts1 T C 8: 69,140,605 probably null Het
Matr3 A T 18: 35,588,395 N473I probably damaging Het
Med1 A G 11: 98,161,182 V452A probably damaging Het
Napsa T A 7: 44,582,485 D44E probably damaging Het
Nbeal1 T C 1: 60,251,352 F1036S probably damaging Het
Ncapg2 G A 12: 116,420,729 W270* probably null Het
Olfr312 C A 11: 58,831,213 Q20K probably benign Het
Pik3ca G A 3: 32,462,794 W1057* probably null Het
Pkd1l2 A T 8: 117,043,317 D1133E probably benign Het
Prox1 T A 1: 190,161,882 E122V probably damaging Het
Rest C A 5: 77,268,187 H83N probably benign Het
RP23-114B10.6 A T 8: 69,373,580 M112K unknown Het
Rundc3a A G 11: 102,397,665 I68V probably damaging Het
Slc9a3r1 G A 11: 115,163,628 V35M probably benign Het
Stx6 A T 1: 155,201,960 I238L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqln3 C A 7: 104,141,049 Q611H probably damaging Het
Usp6nl T A 2: 6,440,959 H559Q probably benign Het
Vipr1 T G 9: 121,665,184 V277G probably benign Het
Zfp101 A T 17: 33,380,998 C595S probably benign Het
Zfp398 C T 6: 47,863,209 T124I possibly damaging Het
Other mutations in Col6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Col6a6 APN 9 105758191 critical splice acceptor site probably null
IGL00768:Col6a6 APN 9 105782412 missense probably benign 0.04
IGL00917:Col6a6 APN 9 105784254 splice site probably benign
IGL01385:Col6a6 APN 9 105783666 missense probably damaging 1.00
IGL01411:Col6a6 APN 9 105785958 nonsense probably null
IGL01508:Col6a6 APN 9 105727166 splice site probably benign
IGL01668:Col6a6 APN 9 105709271 missense probably damaging 1.00
IGL01733:Col6a6 APN 9 105709255 missense possibly damaging 0.92
IGL01932:Col6a6 APN 9 105689626 missense probably benign 0.02
IGL01934:Col6a6 APN 9 105698659 critical splice donor site probably null
IGL01944:Col6a6 APN 9 105783909 missense probably damaging 1.00
IGL01980:Col6a6 APN 9 105780985 missense probably damaging 0.96
IGL02114:Col6a6 APN 9 105767199 critical splice donor site probably null
IGL02129:Col6a6 APN 9 105736340 splice site probably benign
IGL02201:Col6a6 APN 9 105780995 missense probably damaging 1.00
IGL02335:Col6a6 APN 9 105784101 missense probably damaging 1.00
IGL02541:Col6a6 APN 9 105732216 missense probably benign 0.05
IGL02574:Col6a6 APN 9 105782191 missense probably damaging 1.00
IGL02649:Col6a6 APN 9 105727170 critical splice donor site probably null
IGL02852:Col6a6 APN 9 105784073 missense probably damaging 0.99
IGL03278:Col6a6 APN 9 105709452 missense probably benign 0.01
IGL03327:Col6a6 APN 9 105767234 missense possibly damaging 0.90
PIT4519001:Col6a6 UTSW 9 105732263 missense probably benign 0.23
R0042:Col6a6 UTSW 9 105780697 missense possibly damaging 0.89
R0046:Col6a6 UTSW 9 105748848 splice site probably benign
R0066:Col6a6 UTSW 9 105702213 missense probably damaging 0.99
R0066:Col6a6 UTSW 9 105702213 missense probably damaging 0.99
R0140:Col6a6 UTSW 9 105702275 missense probably damaging 1.00
R0278:Col6a6 UTSW 9 105767288 missense possibly damaging 0.87
R0281:Col6a6 UTSW 9 105784116 missense probably benign 0.13
R0382:Col6a6 UTSW 9 105755555 missense probably damaging 0.98
R0389:Col6a6 UTSW 9 105784204 missense probably benign 0.02
R0421:Col6a6 UTSW 9 105784206 missense probably benign 0.02
R0502:Col6a6 UTSW 9 105767351 missense probably benign 0.04
R0503:Col6a6 UTSW 9 105767351 missense probably benign 0.04
R0600:Col6a6 UTSW 9 105761440 missense probably damaging 1.00
R0626:Col6a6 UTSW 9 105777744 missense probably benign 0.45
R0629:Col6a6 UTSW 9 105727165 splice site probably benign
R0690:Col6a6 UTSW 9 105709486 missense probably benign 0.01
R1155:Col6a6 UTSW 9 105782090 missense possibly damaging 0.64
R1245:Col6a6 UTSW 9 105748910 missense possibly damaging 0.62
R1253:Col6a6 UTSW 9 105774303 missense probably null 0.98
R1263:Col6a6 UTSW 9 105709489 missense probably benign 0.01
R1296:Col6a6 UTSW 9 105781091 missense probably damaging 1.00
R1556:Col6a6 UTSW 9 105709473 missense possibly damaging 0.82
R1600:Col6a6 UTSW 9 105778075 missense probably damaging 1.00
R1612:Col6a6 UTSW 9 105777549 missense probably damaging 1.00
R1613:Col6a6 UTSW 9 105732211 critical splice donor site probably null
R1830:Col6a6 UTSW 9 105702270 missense probably damaging 0.99
R1858:Col6a6 UTSW 9 105781102 missense probably damaging 1.00
R1897:Col6a6 UTSW 9 105785744 missense possibly damaging 0.74
R1944:Col6a6 UTSW 9 105709384 missense probably damaging 1.00
R2484:Col6a6 UTSW 9 105780804 missense probably damaging 0.98
R3079:Col6a6 UTSW 9 105754223 missense probably benign 0.01
R3176:Col6a6 UTSW 9 105786230 missense probably benign 0.01
R3276:Col6a6 UTSW 9 105786230 missense probably benign 0.01
R3429:Col6a6 UTSW 9 105777967 missense probably damaging 1.00
R3716:Col6a6 UTSW 9 105782174 missense probably damaging 0.98
R3809:Col6a6 UTSW 9 105780692 missense probably damaging 1.00
R3978:Col6a6 UTSW 9 105698879 missense probably damaging 0.98
R4087:Col6a6 UTSW 9 105783956 missense possibly damaging 0.68
R4382:Col6a6 UTSW 9 105783690 missense probably damaging 1.00
R4516:Col6a6 UTSW 9 105698949 missense possibly damaging 0.64
R4666:Col6a6 UTSW 9 105767342 missense possibly damaging 0.93
R4905:Col6a6 UTSW 9 105767424 missense probably damaging 1.00
R4923:Col6a6 UTSW 9 105788948 missense probably damaging 1.00
R4951:Col6a6 UTSW 9 105767198 critical splice donor site probably null
R5002:Col6a6 UTSW 9 105786093 missense probably benign 0.00
R5111:Col6a6 UTSW 9 105709474 missense possibly damaging 0.70
R5205:Col6a6 UTSW 9 105782033 missense probably damaging 0.99
R5399:Col6a6 UTSW 9 105709107 missense possibly damaging 0.50
R5475:Col6a6 UTSW 9 105774338 missense probably null 0.79
R5491:Col6a6 UTSW 9 105738236 missense probably damaging 0.98
R5758:Col6a6 UTSW 9 105761518 critical splice acceptor site probably null
R5934:Col6a6 UTSW 9 105767075 missense probably damaging 1.00
R6059:Col6a6 UTSW 9 105783917 missense probably damaging 1.00
R6284:Col6a6 UTSW 9 105727227 splice site probably null
R6425:Col6a6 UTSW 9 105698865 missense probably benign 0.21
R6464:Col6a6 UTSW 9 105788953 start codon destroyed probably null 0.60
R6469:Col6a6 UTSW 9 105698691 missense probably damaging 0.97
R6520:Col6a6 UTSW 9 105785825 missense possibly damaging 0.89
R6552:Col6a6 UTSW 9 105698913 missense probably damaging 1.00
R6750:Col6a6 UTSW 9 105783680 missense probably damaging 1.00
R6813:Col6a6 UTSW 9 105783941 missense probably benign 0.32
R7032:Col6a6 UTSW 9 105767508 missense probably damaging 0.96
R7260:Col6a6 UTSW 9 105783969 missense probably benign 0.00
R7472:Col6a6 UTSW 9 105782423 missense probably damaging 1.00
R7541:Col6a6 UTSW 9 105767324 missense probably damaging 1.00
R7640:Col6a6 UTSW 9 105785744 missense possibly damaging 0.74
R7645:Col6a6 UTSW 9 105767198 critical splice donor site probably null
R7716:Col6a6 UTSW 9 105783903 missense possibly damaging 0.84
R7866:Col6a6 UTSW 9 105689561 missense probably damaging 0.96
R7938:Col6a6 UTSW 9 105780684 nonsense probably null
R8016:Col6a6 UTSW 9 105767528 missense possibly damaging 0.73
R8043:Col6a6 UTSW 9 105699020 missense probably damaging 0.98
R8073:Col6a6 UTSW 9 105781947 missense probably benign 0.01
R8082:Col6a6 UTSW 9 105783930 nonsense probably null
R8243:Col6a6 UTSW 9 105699269 missense probably damaging 1.00
R8306:Col6a6 UTSW 9 105784073 missense probably damaging 0.96
R8324:Col6a6 UTSW 9 105755654 missense probably benign 0.25
R8384:Col6a6 UTSW 9 105755694 missense probably damaging 1.00
R8400:Col6a6 UTSW 9 105774796 missense probably damaging 1.00
R8523:Col6a6 UTSW 9 105774788 missense possibly damaging 0.71
R8842:Col6a6 UTSW 9 105777967 missense probably damaging 1.00
R8862:Col6a6 UTSW 9 105786149 missense probably damaging 1.00
R8907:Col6a6 UTSW 9 105767329 missense probably damaging 0.99
R9021:Col6a6 UTSW 9 105709546 missense possibly damaging 0.85
R9088:Col6a6 UTSW 9 105784077 missense probably damaging 0.99
R9178:Col6a6 UTSW 9 105781970 missense probably benign 0.30
R9225:Col6a6 UTSW 9 105782238 missense possibly damaging 0.75
R9340:Col6a6 UTSW 9 105774558 missense probably damaging 1.00
R9342:Col6a6 UTSW 9 105785973 missense probably benign 0.00
R9360:Col6a6 UTSW 9 105767487 missense probably benign 0.00
R9368:Col6a6 UTSW 9 105786101 missense possibly damaging 0.48
R9398:Col6a6 UTSW 9 105774626 missense probably benign 0.40
R9450:Col6a6 UTSW 9 105784174 missense probably benign
R9454:Col6a6 UTSW 9 105783860 missense probably damaging 0.99
R9458:Col6a6 UTSW 9 105709162 missense probably benign 0.01
R9563:Col6a6 UTSW 9 105695753 missense probably benign 0.02
R9568:Col6a6 UTSW 9 105780727 missense possibly damaging 0.58
R9613:Col6a6 UTSW 9 105739202 missense probably benign 0.07
X0022:Col6a6 UTSW 9 105699332 missense probably damaging 1.00
Z1176:Col6a6 UTSW 9 105780952 missense probably damaging 1.00
Z1177:Col6a6 UTSW 9 105728255 missense probably damaging 1.00
Z1177:Col6a6 UTSW 9 105788895 missense probably null 0.24
Predicted Primers PCR Primer
(F):5'- CTATGCAGACTCATAGTTTCTGTG -3'
(R):5'- CAGACAGGCCTTGTTTATTATGAC -3'

Sequencing Primer
(F):5'- GAATCTTTACCTGAGATCCCTCG -3'
(R):5'- AGGCCTTGTTTATTATGACAGCTTC -3'
Posted On 2014-10-30