Incidental Mutation 'R7640:Col6a6'
ID 590192
Institutional Source Beutler Lab
Gene Symbol Col6a6
Ensembl Gene ENSMUSG00000043719
Gene Name collagen, type VI, alpha 6
Synonyms E330026B02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # R7640 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 105687809-105828160 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 105785744 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 198 (M198K)
Ref Sequence ENSEMBL: ENSMUSP00000096040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060896] [ENSMUST00000098441] [ENSMUST00000166431]
AlphaFold Q8C6K9
Predicted Effect probably damaging
Transcript: ENSMUST00000060896
AA Change: M198K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000060840
Gene: ENSMUSG00000043719
AA Change: M198K

DomainStartEndE-ValueType
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000098441
AA Change: M198K

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000096040
Gene: ENSMUSG00000043719
AA Change: M198K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 3.3e-9 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166431
AA Change: M198K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000125765
Gene: ENSMUSG00000043719
AA Change: M198K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 9.3e-10 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Meta Mutation Damage Score 0.7492 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,454,594 N20I probably damaging Het
1700020D05Rik T A 19: 5,503,007 S249C probably damaging Het
4930558K02Rik A G 1: 161,957,149 S74P probably benign Het
4932415D10Rik T A 10: 82,294,656 N840I probably damaging Het
Abcb6 A T 1: 75,174,845 probably null Het
Adamts14 C A 10: 61,246,057 A234S probably benign Het
Ankrd42 A G 7: 92,619,635 S167P probably benign Het
Ap3m1 T C 14: 21,038,175 I272V probably benign Het
Armt1 T C 10: 4,453,572 F219S probably damaging Het
Atr T G 9: 95,907,293 probably null Het
Cep72 G A 13: 74,058,488 Q72* probably null Het
Clock G T 5: 76,248,378 L175M possibly damaging Het
Cnmd T A 14: 79,661,534 Y26F possibly damaging Het
Cuta C T 17: 26,938,422 V135I probably benign Het
Ddx41 A T 13: 55,534,239 M241K possibly damaging Het
Dnajc22 A G 15: 99,101,114 N60S probably damaging Het
Drc3 A G 11: 60,388,904 M432V probably benign Het
Eef1d C A 15: 75,902,707 G368C probably damaging Het
En2 A T 5: 28,170,166 K236* probably null Het
Fas A G 19: 34,307,164 T24A possibly damaging Het
Gm13078 T C 4: 143,726,706 V128A probably benign Het
Golga2 T C 2: 32,306,239 V930A probably benign Het
Gprin2 G T 14: 34,195,753 A20D probably benign Het
Ighv14-4 A T 12: 114,176,444 C115* probably null Het
Impdh2 T C 9: 108,565,181 Y459H possibly damaging Het
Klhdc7b G T 15: 89,387,260 V124L possibly damaging Het
L2hgdh A T 12: 69,721,357 Y122* probably null Het
Lamc2 A T 1: 153,136,804 I708N possibly damaging Het
Large2 T C 2: 92,374,705 M1V probably null Het
Lrit2 T C 14: 37,072,124 W382R probably damaging Het
Mcee T A 7: 64,411,968 V173E probably damaging Het
Mcph1 T A 8: 18,632,326 V493E probably benign Het
Mfap4 A G 11: 61,487,087 N118D probably damaging Het
Mknk2 T C 10: 80,668,566 S301G probably benign Het
Mlf1 G A 3: 67,392,933 M94I possibly damaging Het
Mrc2 T A 11: 105,332,295 S455T possibly damaging Het
Mrgprb5 T G 7: 48,168,259 I243L probably benign Het
Muc4 C A 16: 32,760,105 P360T Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Nts T C 10: 102,490,304 Q7R possibly damaging Het
Oas1b T C 5: 120,821,414 L288P probably damaging Het
Olfr1076 A G 2: 86,508,943 I161M possibly damaging Het
Olfr1131 A G 2: 87,629,092 I94V probably benign Het
Olfr1196 T A 2: 88,700,886 I148L probably benign Het
Olfr633 A T 7: 103,946,943 I126F probably damaging Het
Otoa A G 7: 121,145,626 E869G probably damaging Het
Pcdhac2 T C 18: 37,144,525 L186P probably damaging Het
Plekhh2 A G 17: 84,610,776 E1271G possibly damaging Het
Pmepa1 C T 2: 173,276,163 A8T probably benign Het
Rc3h2 A G 2: 37,377,849 probably null Het
Rlf T A 4: 121,146,801 M1771L possibly damaging Het
Rpap1 G A 2: 119,764,410 P1372L possibly damaging Het
Rragd A T 4: 32,983,527 D22V probably benign Het
Sema3f A T 9: 107,683,575 S644R probably benign Het
Sp110 G A 1: 85,579,092 R417C probably benign Het
Specc1l T A 10: 75,257,869 N717K probably damaging Het
Sphkap C T 1: 83,278,928 D367N possibly damaging Het
Tbc1d21 C T 9: 58,361,261 V272M probably damaging Het
Tmem132c A G 5: 127,563,006 D747G probably damaging Het
Tmem56 A G 3: 121,235,041 probably null Het
Trim2 C A 3: 84,190,906 V372F probably benign Het
Ttc34 A G 4: 154,861,384 T292A probably benign Het
Ube3b A G 5: 114,415,323 T919A probably benign Het
Wdr34 T G 2: 30,031,768 D527A probably benign Het
Zfhx4 T C 3: 5,412,480 I3385T probably benign Het
Zfp423 T C 8: 87,781,277 K813R probably damaging Het
Zfp850 T C 7: 27,989,209 T525A probably benign Het
Zfp873 T C 10: 82,060,275 I280T possibly damaging Het
Zkscan7 A G 9: 122,896,056 T697A possibly damaging Het
Other mutations in Col6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Col6a6 APN 9 105758191 critical splice acceptor site probably null
IGL00768:Col6a6 APN 9 105782412 missense probably benign 0.04
IGL00917:Col6a6 APN 9 105784254 splice site probably benign
IGL01385:Col6a6 APN 9 105783666 missense probably damaging 1.00
IGL01411:Col6a6 APN 9 105785958 nonsense probably null
IGL01508:Col6a6 APN 9 105727166 splice site probably benign
IGL01668:Col6a6 APN 9 105709271 missense probably damaging 1.00
IGL01733:Col6a6 APN 9 105709255 missense possibly damaging 0.92
IGL01932:Col6a6 APN 9 105689626 missense probably benign 0.02
IGL01934:Col6a6 APN 9 105698659 critical splice donor site probably null
IGL01944:Col6a6 APN 9 105783909 missense probably damaging 1.00
IGL01980:Col6a6 APN 9 105780985 missense probably damaging 0.96
IGL02114:Col6a6 APN 9 105767199 critical splice donor site probably null
IGL02129:Col6a6 APN 9 105736340 splice site probably benign
IGL02201:Col6a6 APN 9 105780995 missense probably damaging 1.00
IGL02335:Col6a6 APN 9 105784101 missense probably damaging 1.00
IGL02541:Col6a6 APN 9 105732216 missense probably benign 0.05
IGL02574:Col6a6 APN 9 105782191 missense probably damaging 1.00
IGL02649:Col6a6 APN 9 105727170 critical splice donor site probably null
IGL02852:Col6a6 APN 9 105784073 missense probably damaging 0.99
IGL03278:Col6a6 APN 9 105709452 missense probably benign 0.01
IGL03327:Col6a6 APN 9 105767234 missense possibly damaging 0.90
PIT4519001:Col6a6 UTSW 9 105732263 missense probably benign 0.23
R0042:Col6a6 UTSW 9 105780697 missense possibly damaging 0.89
R0046:Col6a6 UTSW 9 105748848 splice site probably benign
R0066:Col6a6 UTSW 9 105702213 missense probably damaging 0.99
R0066:Col6a6 UTSW 9 105702213 missense probably damaging 0.99
R0140:Col6a6 UTSW 9 105702275 missense probably damaging 1.00
R0278:Col6a6 UTSW 9 105767288 missense possibly damaging 0.87
R0281:Col6a6 UTSW 9 105784116 missense probably benign 0.13
R0382:Col6a6 UTSW 9 105755555 missense probably damaging 0.98
R0389:Col6a6 UTSW 9 105784204 missense probably benign 0.02
R0421:Col6a6 UTSW 9 105784206 missense probably benign 0.02
R0502:Col6a6 UTSW 9 105767351 missense probably benign 0.04
R0503:Col6a6 UTSW 9 105767351 missense probably benign 0.04
R0600:Col6a6 UTSW 9 105761440 missense probably damaging 1.00
R0626:Col6a6 UTSW 9 105777744 missense probably benign 0.45
R0629:Col6a6 UTSW 9 105727165 splice site probably benign
R0690:Col6a6 UTSW 9 105709486 missense probably benign 0.01
R1155:Col6a6 UTSW 9 105782090 missense possibly damaging 0.64
R1245:Col6a6 UTSW 9 105748910 missense possibly damaging 0.62
R1253:Col6a6 UTSW 9 105774303 missense probably null 0.98
R1263:Col6a6 UTSW 9 105709489 missense probably benign 0.01
R1296:Col6a6 UTSW 9 105781091 missense probably damaging 1.00
R1556:Col6a6 UTSW 9 105709473 missense possibly damaging 0.82
R1600:Col6a6 UTSW 9 105778075 missense probably damaging 1.00
R1612:Col6a6 UTSW 9 105777549 missense probably damaging 1.00
R1613:Col6a6 UTSW 9 105732211 critical splice donor site probably null
R1830:Col6a6 UTSW 9 105702270 missense probably damaging 0.99
R1858:Col6a6 UTSW 9 105781102 missense probably damaging 1.00
R1897:Col6a6 UTSW 9 105785744 missense possibly damaging 0.74
R1944:Col6a6 UTSW 9 105709384 missense probably damaging 1.00
R2366:Col6a6 UTSW 9 105755694 missense probably damaging 1.00
R2484:Col6a6 UTSW 9 105780804 missense probably damaging 0.98
R3079:Col6a6 UTSW 9 105754223 missense probably benign 0.01
R3176:Col6a6 UTSW 9 105786230 missense probably benign 0.01
R3276:Col6a6 UTSW 9 105786230 missense probably benign 0.01
R3429:Col6a6 UTSW 9 105777967 missense probably damaging 1.00
R3716:Col6a6 UTSW 9 105782174 missense probably damaging 0.98
R3809:Col6a6 UTSW 9 105780692 missense probably damaging 1.00
R3978:Col6a6 UTSW 9 105698879 missense probably damaging 0.98
R4087:Col6a6 UTSW 9 105783956 missense possibly damaging 0.68
R4382:Col6a6 UTSW 9 105783690 missense probably damaging 1.00
R4516:Col6a6 UTSW 9 105698949 missense possibly damaging 0.64
R4666:Col6a6 UTSW 9 105767342 missense possibly damaging 0.93
R4905:Col6a6 UTSW 9 105767424 missense probably damaging 1.00
R4923:Col6a6 UTSW 9 105788948 missense probably damaging 1.00
R4951:Col6a6 UTSW 9 105767198 critical splice donor site probably null
R5002:Col6a6 UTSW 9 105786093 missense probably benign 0.00
R5111:Col6a6 UTSW 9 105709474 missense possibly damaging 0.70
R5205:Col6a6 UTSW 9 105782033 missense probably damaging 0.99
R5399:Col6a6 UTSW 9 105709107 missense possibly damaging 0.50
R5475:Col6a6 UTSW 9 105774338 missense probably null 0.79
R5491:Col6a6 UTSW 9 105738236 missense probably damaging 0.98
R5758:Col6a6 UTSW 9 105761518 critical splice acceptor site probably null
R5934:Col6a6 UTSW 9 105767075 missense probably damaging 1.00
R6059:Col6a6 UTSW 9 105783917 missense probably damaging 1.00
R6284:Col6a6 UTSW 9 105727227 splice site probably null
R6425:Col6a6 UTSW 9 105698865 missense probably benign 0.21
R6464:Col6a6 UTSW 9 105788953 start codon destroyed probably null 0.60
R6469:Col6a6 UTSW 9 105698691 missense probably damaging 0.97
R6520:Col6a6 UTSW 9 105785825 missense possibly damaging 0.89
R6552:Col6a6 UTSW 9 105698913 missense probably damaging 1.00
R6750:Col6a6 UTSW 9 105783680 missense probably damaging 1.00
R6813:Col6a6 UTSW 9 105783941 missense probably benign 0.32
R7032:Col6a6 UTSW 9 105767508 missense probably damaging 0.96
R7260:Col6a6 UTSW 9 105783969 missense probably benign 0.00
R7472:Col6a6 UTSW 9 105782423 missense probably damaging 1.00
R7541:Col6a6 UTSW 9 105767324 missense probably damaging 1.00
R7645:Col6a6 UTSW 9 105767198 critical splice donor site probably null
R7716:Col6a6 UTSW 9 105783903 missense possibly damaging 0.84
R7866:Col6a6 UTSW 9 105689561 missense probably damaging 0.96
R7938:Col6a6 UTSW 9 105780684 nonsense probably null
R8016:Col6a6 UTSW 9 105767528 missense possibly damaging 0.73
R8043:Col6a6 UTSW 9 105699020 missense probably damaging 0.98
R8073:Col6a6 UTSW 9 105781947 missense probably benign 0.01
R8082:Col6a6 UTSW 9 105783930 nonsense probably null
R8243:Col6a6 UTSW 9 105699269 missense probably damaging 1.00
R8306:Col6a6 UTSW 9 105784073 missense probably damaging 0.96
R8324:Col6a6 UTSW 9 105755654 missense probably benign 0.25
R8384:Col6a6 UTSW 9 105755694 missense probably damaging 1.00
R8400:Col6a6 UTSW 9 105774796 missense probably damaging 1.00
R8523:Col6a6 UTSW 9 105774788 missense possibly damaging 0.71
R8842:Col6a6 UTSW 9 105777967 missense probably damaging 1.00
R8862:Col6a6 UTSW 9 105786149 missense probably damaging 1.00
R8907:Col6a6 UTSW 9 105767329 missense probably damaging 0.99
R9021:Col6a6 UTSW 9 105709546 missense possibly damaging 0.85
R9088:Col6a6 UTSW 9 105784077 missense probably damaging 0.99
R9178:Col6a6 UTSW 9 105781970 missense probably benign 0.30
R9225:Col6a6 UTSW 9 105782238 missense possibly damaging 0.75
R9340:Col6a6 UTSW 9 105774558 missense probably damaging 1.00
R9342:Col6a6 UTSW 9 105785973 missense probably benign 0.00
R9360:Col6a6 UTSW 9 105767487 missense probably benign 0.00
R9368:Col6a6 UTSW 9 105786101 missense possibly damaging 0.48
R9398:Col6a6 UTSW 9 105774626 missense probably benign 0.40
R9450:Col6a6 UTSW 9 105784174 missense probably benign
R9454:Col6a6 UTSW 9 105783860 missense probably damaging 0.99
R9458:Col6a6 UTSW 9 105709162 missense probably benign 0.01
R9563:Col6a6 UTSW 9 105695753 missense probably benign 0.02
R9568:Col6a6 UTSW 9 105780727 missense possibly damaging 0.58
R9613:Col6a6 UTSW 9 105739202 missense probably benign 0.07
X0022:Col6a6 UTSW 9 105699332 missense probably damaging 1.00
Z1176:Col6a6 UTSW 9 105780952 missense probably damaging 1.00
Z1177:Col6a6 UTSW 9 105728255 missense probably damaging 1.00
Z1177:Col6a6 UTSW 9 105788895 missense probably null 0.24
Predicted Primers PCR Primer
(F):5'- GCTCACTGTCCTGGTAAATCTTG -3'
(R):5'- TCAGCAGAGTCTGAGGATGATG -3'

Sequencing Primer
(F):5'- TCCATCAAATTGGCCTGAGG -3'
(R):5'- TGATGTGGAAGAGGCTGCG -3'
Posted On 2019-10-24