Mutagenetix > Incidental Mutation

Incidental Mutation 'R0629:Col6a6'

57762

Institutional Source

Beutler Lab

Gene Symbol

Col6a6

Ensembl Gene

ENSMUSG00000043719

Gene Name

collagen, type VI, alpha 6

Synonyms

E330026B02Rik

MMRRC Submission

038818-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.128) question?

Stock #

R0629 (G1)

Quality Score

184

Status

Validated

Chromosome

Chromosomal Location

105687809-105828160 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 105727165 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000125765 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098441] [ENSMUST00000166431]

AlphaFold

Q8C6K9

Predicted Effect

probably benign
Transcript: ENSMUST00000098441

SMART Domains

Protein: ENSMUSP00000096040
Gene: ENSMUSG00000043719

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
VWA	24	197	4.26e-26	SMART
VWA	226	407	1.06e-30	SMART
VWA	433	610	5.19e-39	SMART
VWA	619	795	3.58e-42	SMART
VWA	806	982	6.64e-37	SMART
VWA	997	1175	2.7e-37	SMART
VWA	1184	1370	3.45e-1	SMART
Pfam:Collagen	1389	1450	3.3e-9	PFAM
low complexity region	1451	1475	N/A	INTRINSIC
low complexity region	1490	1508	N/A	INTRINSIC
low complexity region	1602	1623	N/A	INTRINSIC
low complexity region	1698	1724	N/A	INTRINSIC
VWA	1754	1937	1.73e-17	SMART
VWA	1962	2145	4.4e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166431

SMART Domains

Protein: ENSMUSP00000125765
Gene: ENSMUSG00000043719

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
VWA	24	197	4.26e-26	SMART
VWA	226	407	1.06e-30	SMART
VWA	433	610	5.19e-39	SMART
VWA	619	795	3.58e-42	SMART
VWA	806	982	6.64e-37	SMART
VWA	997	1175	2.7e-37	SMART
VWA	1184	1370	3.45e-1	SMART
Pfam:Collagen	1389	1450	9.3e-10	PFAM
low complexity region	1451	1475	N/A	INTRINSIC
low complexity region	1490	1508	N/A	INTRINSIC
low complexity region	1602	1623	N/A	INTRINSIC
low complexity region	1698	1724	N/A	INTRINSIC
VWA	1754	1937	1.73e-17	SMART
VWA	1962	2145	4.4e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195709

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.6%

Validation Efficiency

100% (66/66)

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	A	T	17: 45,507,547	D86V	probably damaging	Het
Adamts14	G	A	10: 61,211,624	Q733*	probably null	Het
Adcy10	A	G	1: 165,543,105	D651G	probably damaging	Het
Apcdd1	T	A	18: 62,933,970	C52S	probably damaging	Het
Bclaf1	T	C	10: 20,333,426	S463P	probably damaging	Het
Cabcoco1	T	C	10: 68,516,278	Y68C	probably damaging	Het
Cacna1f	G	A	X: 7,620,434	S888N	probably damaging	Het
Cacna1g	A	G	11: 94,409,543	C2134R	possibly damaging	Het
Cdc37	A	C	9: 21,140,768	M325R	possibly damaging	Het
Clca2	T	A	3: 145,072,239	M762L	probably benign	Het
Cntn3	C	T	6: 102,203,976	V753M	probably damaging	Het
Dscaml1	A	G	9: 45,721,418	D1194G	probably damaging	Het
Egfr	G	A	11: 16,869,333	G288S	probably damaging	Het
Fbxl17	G	T	17: 63,471,414	N19K	probably damaging	Het
Fmo3	A	G	1: 162,958,227		probably benign	Het
Frmd6	T	C	12: 70,883,762	Y219H	probably damaging	Het
Fuca1	T	C	4: 135,925,644	V193A	possibly damaging	Het
Gm1141	G	C	X: 71,938,773	R296P	possibly damaging	Het
Gm7461	C	T	8: 4,677,769		noncoding transcript	Het
Gpc5	T	A	14: 115,552,239	N508K	possibly damaging	Het
Iqch	A	T	9: 63,425,382	D1019E	probably benign	Het
Isyna1	A	G	8: 70,594,708	Y27C	probably damaging	Het
Itgb8	T	G	12: 119,202,481	H105P	probably benign	Het
Kbtbd11	C	T	8: 15,027,572	P57L	probably benign	Het
Kcns3	A	C	12: 11,092,558	C47G	probably damaging	Het
Kif21b	A	T	1: 136,172,157		probably null	Het
Lama3	A	T	18: 12,419,245	H418L	possibly damaging	Het
Lrit3	A	G	3: 129,788,302	Y679H	probably damaging	Het
Lrrc19	T	A	4: 94,638,252	D356V	probably damaging	Het
Morc2b	A	G	17: 33,135,807	M997T	probably benign	Het
Mroh9	T	C	1: 163,060,636	H290R	possibly damaging	Het
Mtcl1	A	T	17: 66,338,142	S1886T	possibly damaging	Het
Muc20	T	C	16: 32,793,421	T529A	possibly damaging	Het
Myo7a	A	C	7: 98,085,466	L607R	probably damaging	Het
Myom2	T	A	8: 15,069,783	F180I	probably damaging	Het
Myt1l	G	A	12: 29,811,485	E89K	unknown	Het
Nek2	A	G	1: 191,831,317	N431S	probably benign	Het
Olfr1086	T	A	2: 86,676,529	H268L	possibly damaging	Het
Olfr169	A	T	16: 19,565,980	V301E	possibly damaging	Het
Oprm1	A	T	10: 6,832,604		probably null	Het
Oxsr1	A	G	9: 119,241,784		probably benign	Het
Pdgfrb	G	A	18: 61,078,648		probably null	Het
Proser1	C	A	3: 53,479,064	P789Q	probably benign	Het
Ptgs2	A	G	1: 150,101,037	Q7R	probably benign	Het
Rab3d	A	G	9: 21,914,686	V144A	probably benign	Het
Ralgapb	T	A	2: 158,439,547	L167H	probably damaging	Het
Ranbp3	A	G	17: 56,708,200	T301A	possibly damaging	Het
Rasgrf1	G	A	9: 89,984,269	V587M	probably damaging	Het
Sec16b	A	G	1: 157,564,863		probably benign	Het
Sin3b	T	C	8: 72,753,536		probably benign	Het
Slc10a2	T	C	8: 5,098,562	S128G	probably benign	Het
Tbl1xr1	G	A	3: 22,210,401	V507I	probably benign	Het
Tmem8b	T	G	4: 43,669,896		probably null	Het
Trak1	A	T	9: 121,367,167	T22S	probably benign	Het
Trim30d	A	G	7: 104,487,655	I114T	probably damaging	Het
Ttc13	A	T	8: 124,674,366	S624T	probably damaging	Het
Ttn	T	C	2: 76,828,130		probably benign	Het
Vipr1	T	A	9: 121,660,171	Y99*	probably null	Het
Vmn1r210	T	C	13: 22,827,874	K81E	probably damaging	Het
Wwc1	T	C	11: 35,853,472	Y841C	probably benign	Het
Xrcc4	A	G	13: 90,000,905		probably benign	Het
Zdhhc22	A	T	12: 86,988,297	I127N	probably damaging	Het
Zdhhc7	A	G	8: 120,088,046	L8P	possibly damaging	Het
Zfp664	C	A	5: 124,885,595	L18I	probably damaging	Het

Other mutations in Col6a6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Col6a6	APN	9	105758191	critical splice acceptor site	probably null
IGL00768:Col6a6	APN	9	105782412	missense	probably benign	0.04
IGL00917:Col6a6	APN	9	105784254	splice site	probably benign
IGL01385:Col6a6	APN	9	105783666	missense	probably damaging	1.00
IGL01411:Col6a6	APN	9	105785958	nonsense	probably null
IGL01508:Col6a6	APN	9	105727166	splice site	probably benign
IGL01668:Col6a6	APN	9	105709271	missense	probably damaging	1.00
IGL01733:Col6a6	APN	9	105709255	missense	possibly damaging	0.92
IGL01932:Col6a6	APN	9	105689626	missense	probably benign	0.02
IGL01934:Col6a6	APN	9	105698659	critical splice donor site	probably null
IGL01944:Col6a6	APN	9	105783909	missense	probably damaging	1.00
IGL01980:Col6a6	APN	9	105780985	missense	probably damaging	0.96
IGL02114:Col6a6	APN	9	105767199	critical splice donor site	probably null
IGL02129:Col6a6	APN	9	105736340	splice site	probably benign
IGL02201:Col6a6	APN	9	105780995	missense	probably damaging	1.00
IGL02335:Col6a6	APN	9	105784101	missense	probably damaging	1.00
IGL02541:Col6a6	APN	9	105732216	missense	probably benign	0.05
IGL02574:Col6a6	APN	9	105782191	missense	probably damaging	1.00
IGL02649:Col6a6	APN	9	105727170	critical splice donor site	probably null
IGL02852:Col6a6	APN	9	105784073	missense	probably damaging	0.99
IGL03278:Col6a6	APN	9	105709452	missense	probably benign	0.01
IGL03327:Col6a6	APN	9	105767234	missense	possibly damaging	0.90
PIT4519001:Col6a6	UTSW	9	105732263	missense	probably benign	0.23
R0042:Col6a6	UTSW	9	105780697	missense	possibly damaging	0.89
R0046:Col6a6	UTSW	9	105748848	splice site	probably benign
R0066:Col6a6	UTSW	9	105702213	missense	probably damaging	0.99
R0066:Col6a6	UTSW	9	105702213	missense	probably damaging	0.99
R0140:Col6a6	UTSW	9	105702275	missense	probably damaging	1.00
R0278:Col6a6	UTSW	9	105767288	missense	possibly damaging	0.87
R0281:Col6a6	UTSW	9	105784116	missense	probably benign	0.13
R0382:Col6a6	UTSW	9	105755555	missense	probably damaging	0.98
R0389:Col6a6	UTSW	9	105784204	missense	probably benign	0.02
R0421:Col6a6	UTSW	9	105784206	missense	probably benign	0.02
R0502:Col6a6	UTSW	9	105767351	missense	probably benign	0.04
R0503:Col6a6	UTSW	9	105767351	missense	probably benign	0.04
R0600:Col6a6	UTSW	9	105761440	missense	probably damaging	1.00
R0626:Col6a6	UTSW	9	105777744	missense	probably benign	0.45
R0690:Col6a6	UTSW	9	105709486	missense	probably benign	0.01
R1155:Col6a6	UTSW	9	105782090	missense	possibly damaging	0.64
R1245:Col6a6	UTSW	9	105748910	missense	possibly damaging	0.62
R1253:Col6a6	UTSW	9	105774303	missense	probably null	0.98
R1263:Col6a6	UTSW	9	105709489	missense	probably benign	0.01
R1296:Col6a6	UTSW	9	105781091	missense	probably damaging	1.00
R1556:Col6a6	UTSW	9	105709473	missense	possibly damaging	0.82
R1600:Col6a6	UTSW	9	105778075	missense	probably damaging	1.00
R1612:Col6a6	UTSW	9	105777549	missense	probably damaging	1.00
R1613:Col6a6	UTSW	9	105732211	critical splice donor site	probably null
R1830:Col6a6	UTSW	9	105702270	missense	probably damaging	0.99
R1858:Col6a6	UTSW	9	105781102	missense	probably damaging	1.00
R1897:Col6a6	UTSW	9	105785744	missense	possibly damaging	0.74
R1944:Col6a6	UTSW	9	105709384	missense	probably damaging	1.00
R2366:Col6a6	UTSW	9	105755694	missense	probably damaging	1.00
R2484:Col6a6	UTSW	9	105780804	missense	probably damaging	0.98
R3079:Col6a6	UTSW	9	105754223	missense	probably benign	0.01
R3176:Col6a6	UTSW	9	105786230	missense	probably benign	0.01
R3276:Col6a6	UTSW	9	105786230	missense	probably benign	0.01
R3429:Col6a6	UTSW	9	105777967	missense	probably damaging	1.00
R3716:Col6a6	UTSW	9	105782174	missense	probably damaging	0.98
R3809:Col6a6	UTSW	9	105780692	missense	probably damaging	1.00
R3978:Col6a6	UTSW	9	105698879	missense	probably damaging	0.98
R4087:Col6a6	UTSW	9	105783956	missense	possibly damaging	0.68
R4382:Col6a6	UTSW	9	105783690	missense	probably damaging	1.00
R4516:Col6a6	UTSW	9	105698949	missense	possibly damaging	0.64
R4666:Col6a6	UTSW	9	105767342	missense	possibly damaging	0.93
R4905:Col6a6	UTSW	9	105767424	missense	probably damaging	1.00
R4923:Col6a6	UTSW	9	105788948	missense	probably damaging	1.00
R4951:Col6a6	UTSW	9	105767198	critical splice donor site	probably null
R5002:Col6a6	UTSW	9	105786093	missense	probably benign	0.00
R5111:Col6a6	UTSW	9	105709474	missense	possibly damaging	0.70
R5205:Col6a6	UTSW	9	105782033	missense	probably damaging	0.99
R5399:Col6a6	UTSW	9	105709107	missense	possibly damaging	0.50
R5475:Col6a6	UTSW	9	105774338	missense	probably null	0.79
R5491:Col6a6	UTSW	9	105738236	missense	probably damaging	0.98
R5758:Col6a6	UTSW	9	105761518	critical splice acceptor site	probably null
R5934:Col6a6	UTSW	9	105767075	missense	probably damaging	1.00
R6059:Col6a6	UTSW	9	105783917	missense	probably damaging	1.00
R6284:Col6a6	UTSW	9	105727227	splice site	probably null
R6425:Col6a6	UTSW	9	105698865	missense	probably benign	0.21
R6464:Col6a6	UTSW	9	105788953	start codon destroyed	probably null	0.60
R6469:Col6a6	UTSW	9	105698691	missense	probably damaging	0.97
R6520:Col6a6	UTSW	9	105785825	missense	possibly damaging	0.89
R6552:Col6a6	UTSW	9	105698913	missense	probably damaging	1.00
R6750:Col6a6	UTSW	9	105783680	missense	probably damaging	1.00
R6813:Col6a6	UTSW	9	105783941	missense	probably benign	0.32
R7032:Col6a6	UTSW	9	105767508	missense	probably damaging	0.96
R7260:Col6a6	UTSW	9	105783969	missense	probably benign	0.00
R7472:Col6a6	UTSW	9	105782423	missense	probably damaging	1.00
R7541:Col6a6	UTSW	9	105767324	missense	probably damaging	1.00
R7640:Col6a6	UTSW	9	105785744	missense	possibly damaging	0.74
R7645:Col6a6	UTSW	9	105767198	critical splice donor site	probably null
R7716:Col6a6	UTSW	9	105783903	missense	possibly damaging	0.84
R7866:Col6a6	UTSW	9	105689561	missense	probably damaging	0.96
R7938:Col6a6	UTSW	9	105780684	nonsense	probably null
R8016:Col6a6	UTSW	9	105767528	missense	possibly damaging	0.73
R8043:Col6a6	UTSW	9	105699020	missense	probably damaging	0.98
R8073:Col6a6	UTSW	9	105781947	missense	probably benign	0.01
R8082:Col6a6	UTSW	9	105783930	nonsense	probably null
R8243:Col6a6	UTSW	9	105699269	missense	probably damaging	1.00
R8306:Col6a6	UTSW	9	105784073	missense	probably damaging	0.96
R8324:Col6a6	UTSW	9	105755654	missense	probably benign	0.25
R8384:Col6a6	UTSW	9	105755694	missense	probably damaging	1.00
R8400:Col6a6	UTSW	9	105774796	missense	probably damaging	1.00
R8523:Col6a6	UTSW	9	105774788	missense	possibly damaging	0.71
R8842:Col6a6	UTSW	9	105777967	missense	probably damaging	1.00
R8862:Col6a6	UTSW	9	105786149	missense	probably damaging	1.00
R8907:Col6a6	UTSW	9	105767329	missense	probably damaging	0.99
R9021:Col6a6	UTSW	9	105709546	missense	possibly damaging	0.85
R9088:Col6a6	UTSW	9	105784077	missense	probably damaging	0.99
R9178:Col6a6	UTSW	9	105781970	missense	probably benign	0.30
R9225:Col6a6	UTSW	9	105782238	missense	possibly damaging	0.75
R9340:Col6a6	UTSW	9	105774558	missense	probably damaging	1.00
R9342:Col6a6	UTSW	9	105785973	missense	probably benign	0.00
R9360:Col6a6	UTSW	9	105767487	missense	probably benign	0.00
R9368:Col6a6	UTSW	9	105786101	missense	possibly damaging	0.48
R9398:Col6a6	UTSW	9	105774626	missense	probably benign	0.40
R9450:Col6a6	UTSW	9	105784174	missense	probably benign
R9454:Col6a6	UTSW	9	105783860	missense	probably damaging	0.99
R9458:Col6a6	UTSW	9	105709162	missense	probably benign	0.01
R9563:Col6a6	UTSW	9	105695753	missense	probably benign	0.02
R9568:Col6a6	UTSW	9	105780727	missense	possibly damaging	0.58
R9613:Col6a6	UTSW	9	105739202	missense	probably benign	0.07
R9664:Col6a6	UTSW	9	105781055	missense	probably benign	0.11
R9747:Col6a6	UTSW	9	105784040	missense	probably benign	0.29
R9760:Col6a6	UTSW	9	105782054	missense	probably damaging	0.99
X0022:Col6a6	UTSW	9	105699332	missense	probably damaging	1.00
Z1176:Col6a6	UTSW	9	105780952	missense	probably damaging	1.00
Z1177:Col6a6	UTSW	9	105728255	missense	probably damaging	1.00
Z1177:Col6a6	UTSW	9	105788895	missense	probably null	0.24

Predicted Primers

PCR Primer
(F):5'- AGCTGGAACATACCAGGTTCTACCC -3'
(R):5'- GCTTCCTAGTGGTTCCCGAAAGAC -3'

Sequencing Primer
(F):5'- AGTACGGACGATTCTTTTTCAAC -3'
(R):5'- GGTTCCCGAAAGACTCCAAAATC -3'

Posted On

2013-07-11