Incidental Mutation 'R3551:Zfp704'
ID268323
Institutional Source Beutler Lab
Gene Symbol Zfp704
Ensembl Gene ENSMUSG00000040209
Gene Namezinc finger protein 704
SynonymsGig1
MMRRC Submission 040668-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3551 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location9427020-9610085 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9474525 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 255 (V255A)
Ref Sequence ENSEMBL: ENSMUSP00000041242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041124] [ENSMUST00000193947]
Predicted Effect probably damaging
Transcript: ENSMUST00000041124
AA Change: V255A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041242
Gene: ENSMUSG00000040209
AA Change: V255A

DomainStartEndE-ValueType
low complexity region 12 94 N/A INTRINSIC
low complexity region 98 129 N/A INTRINSIC
low complexity region 267 290 N/A INTRINSIC
ZnF_C2H2 346 371 3.58e-2 SMART
c-clamp 536 566 1.55e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000193947
AA Change: V105A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141598
Gene: ENSMUSG00000040209
AA Change: V105A

DomainStartEndE-ValueType
low complexity region 117 140 N/A INTRINSIC
ZnF_C2H2 196 221 1.6e-4 SMART
c-clamp 475 505 7.4e-18 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter (null) allele are viable and fertile with no obvious developmental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Adam24 G C 8: 40,679,593 W33C probably benign Het
Adgrl2 A T 3: 148,858,963 V327E probably damaging Het
Aqp7 T A 4: 41,045,329 N17I probably benign Het
Bicra T A 7: 15,979,733 Q848L probably benign Het
C4b T C 17: 34,741,872 E240G possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Clca3a2 T A 3: 144,803,081 N50I probably damaging Het
Dcaf7 A G 11: 106,054,796 T324A probably benign Het
Dnah12 G A 14: 26,770,972 R1230H probably benign Het
Dsg4 G A 18: 20,451,756 V176M probably damaging Het
Ect2l A G 10: 18,163,393 I339T probably damaging Het
Edc4 A T 8: 105,885,494 I138F probably damaging Het
Ercc6l2 T A 13: 63,844,595 V401E probably damaging Het
Gm3269 T A 14: 4,845,893 V260D possibly damaging Het
Gm4076 C T 13: 85,127,150 noncoding transcript Het
Gm4922 A T 10: 18,784,496 N159K probably benign Het
Gm5134 G T 10: 76,000,447 A421S probably benign Het
Gm5724 T C 6: 141,708,596 K647E probably benign Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Ipo4 A G 14: 55,633,103 V288A probably benign Het
Kng2 A G 16: 23,011,995 probably null Het
Lrfn1 T C 7: 28,460,054 L466P possibly damaging Het
Magi1 T A 6: 93,699,629 K916N probably damaging Het
Mms19 T C 19: 41,949,798 T720A probably benign Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Npas2 A T 1: 39,287,562 M43L probably benign Het
Nup43 A G 10: 7,675,014 D216G possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Pear1 A G 3: 87,758,132 F145L probably benign Het
Pgap1 A G 1: 54,530,143 S355P possibly damaging Het
Prr14l A T 5: 32,828,619 probably null Het
Ptpn12 T C 5: 20,989,049 K742E possibly damaging Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Sema4c G C 1: 36,553,723 T138S probably benign Het
Slc4a2 C T 5: 24,430,101 T168M probably benign Het
Spice1 G T 16: 44,357,869 S85I probably damaging Het
Thrb T A 14: 17,963,214 I59N probably damaging Het
Trav7-1 A G 14: 52,655,299 D103G probably damaging Het
Ubap2l G T 3: 90,015,451 T766N unknown Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp759 T C 13: 67,138,967 V194A probably benign Het
Other mutations in Zfp704
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Zfp704 APN 3 9565239 missense possibly damaging 0.61
IGL03288:Zfp704 APN 3 9439891 splice site probably benign
R0265:Zfp704 UTSW 3 9565157 missense probably damaging 1.00
R0524:Zfp704 UTSW 3 9609364 missense unknown
R1466:Zfp704 UTSW 3 9447348 missense possibly damaging 0.94
R1466:Zfp704 UTSW 3 9447348 missense possibly damaging 0.94
R1647:Zfp704 UTSW 3 9471039 missense probably damaging 1.00
R1648:Zfp704 UTSW 3 9471039 missense probably damaging 1.00
R1865:Zfp704 UTSW 3 9474491 splice site probably benign
R1912:Zfp704 UTSW 3 9609358 missense unknown
R2109:Zfp704 UTSW 3 9474525 missense probably damaging 1.00
R2566:Zfp704 UTSW 3 9609493 missense unknown
R4495:Zfp704 UTSW 3 9471077 missense probably benign 0.01
R6165:Zfp704 UTSW 3 9443886 missense probably benign 0.00
R6682:Zfp704 UTSW 3 9565193 missense probably benign 0.11
R7057:Zfp704 UTSW 3 9470917 missense probably damaging 1.00
R7348:Zfp704 UTSW 3 9474598 missense probably damaging 1.00
R7758:Zfp704 UTSW 3 9444222 missense possibly damaging 0.90
R7858:Zfp704 UTSW 3 9444157 critical splice donor site probably null
R8104:Zfp704 UTSW 3 9565241 missense probably benign 0.03
Z1176:Zfp704 UTSW 3 9471044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCTGTGTAGGTGAGCAC -3'
(R):5'- TCTTATCCGTAAAACAACTGGCAG -3'

Sequencing Primer
(F):5'- TGTAGGTGAGCACATCAGTATCC -3'
(R):5'- CAACTGGCAGAACATTGGCTTTTC -3'
Posted On2015-02-19