Incidental Mutation 'R3551:Lrfn1'
ID268339
Institutional Source Beutler Lab
Gene Symbol Lrfn1
Ensembl Gene ENSMUSG00000030600
Gene Nameleucine rich repeat and fibronectin type III domain containing 1
SynonymsSALM2
MMRRC Submission 040668-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.473) question?
Stock #R3551 (G1)
Quality Score115
Status Not validated
Chromosome7
Chromosomal Location28451980-28468242 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28460054 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 466 (L466P)
Ref Sequence ENSEMBL: ENSMUSP00000139609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040531] [ENSMUST00000055110] [ENSMUST00000108288] [ENSMUST00000189877] [ENSMUST00000190954]
Predicted Effect probably benign
Transcript: ENSMUST00000040531
SMART Domains Protein: ENSMUSP00000040486
Gene: ENSMUSG00000109336

DomainStartEndE-ValueType
low complexity region 81 90 N/A INTRINSIC
low complexity region 174 190 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 278 290 N/A INTRINSIC
SAM 296 359 1.02e-9 SMART
low complexity region 406 420 N/A INTRINSIC
low complexity region 433 461 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000055110
AA Change: L466P

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000057645
Gene: ENSMUSG00000030600
AA Change: L466P

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
LRR 88 111 8.67e-1 SMART
LRR 112 135 4.57e0 SMART
LRR_TYP 136 159 1.69e-3 SMART
LRR 161 184 2.54e1 SMART
LRR 185 208 2.32e-1 SMART
LRR 209 233 3.75e0 SMART
LRRCT 252 297 1.36e-3 SMART
IGc2 312 377 1.51e-12 SMART
low complexity region 389 403 N/A INTRINSIC
low complexity region 460 471 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108288
AA Change: L466P

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103923
Gene: ENSMUSG00000030600
AA Change: L466P

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
LRR 88 111 8.67e-1 SMART
LRR 112 135 4.57e0 SMART
LRR_TYP 136 159 1.69e-3 SMART
LRR 161 184 2.54e1 SMART
LRR 185 208 2.32e-1 SMART
LRR 209 233 3.75e0 SMART
LRRCT 252 297 1.36e-3 SMART
IGc2 312 377 1.51e-12 SMART
low complexity region 389 403 N/A INTRINSIC
FN3 422 502 2.68e-2 SMART
transmembrane domain 535 557 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 609 625 N/A INTRINSIC
low complexity region 716 725 N/A INTRINSIC
low complexity region 730 747 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000189877
AA Change: L466P

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139609
Gene: ENSMUSG00000030600
AA Change: L466P

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
LRR 88 111 8.67e-1 SMART
LRR 112 135 4.57e0 SMART
LRR_TYP 136 159 1.69e-3 SMART
LRR 161 184 2.54e1 SMART
LRR 185 208 2.32e-1 SMART
LRR 209 233 3.75e0 SMART
LRRCT 252 297 1.36e-3 SMART
IGc2 312 377 1.51e-12 SMART
low complexity region 389 403 N/A INTRINSIC
low complexity region 460 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190954
SMART Domains Protein: ENSMUSP00000140537
Gene: ENSMUSG00000030600

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Blast:LRRNT 33 69 2e-18 BLAST
LRR 88 111 3.7e-3 SMART
LRR 112 135 1.9e-2 SMART
LRR_TYP 136 159 7.1e-6 SMART
LRR 161 184 1.1e-1 SMART
LRR 185 208 1e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191267
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Adam24 G C 8: 40,679,593 W33C probably benign Het
Adgrl2 A T 3: 148,858,963 V327E probably damaging Het
Aqp7 T A 4: 41,045,329 N17I probably benign Het
Bicra T A 7: 15,979,733 Q848L probably benign Het
C4b T C 17: 34,741,872 E240G possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Clca3a2 T A 3: 144,803,081 N50I probably damaging Het
Dcaf7 A G 11: 106,054,796 T324A probably benign Het
Dnah12 G A 14: 26,770,972 R1230H probably benign Het
Dsg4 G A 18: 20,451,756 V176M probably damaging Het
Ect2l A G 10: 18,163,393 I339T probably damaging Het
Edc4 A T 8: 105,885,494 I138F probably damaging Het
Ercc6l2 T A 13: 63,844,595 V401E probably damaging Het
Gm3269 T A 14: 4,845,893 V260D possibly damaging Het
Gm4076 C T 13: 85,127,150 noncoding transcript Het
Gm4922 A T 10: 18,784,496 N159K probably benign Het
Gm5134 G T 10: 76,000,447 A421S probably benign Het
Gm5724 T C 6: 141,708,596 K647E probably benign Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Ipo4 A G 14: 55,633,103 V288A probably benign Het
Kng2 A G 16: 23,011,995 probably null Het
Magi1 T A 6: 93,699,629 K916N probably damaging Het
Mms19 T C 19: 41,949,798 T720A probably benign Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Npas2 A T 1: 39,287,562 M43L probably benign Het
Nup43 A G 10: 7,675,014 D216G possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Pear1 A G 3: 87,758,132 F145L probably benign Het
Pgap1 A G 1: 54,530,143 S355P possibly damaging Het
Prr14l A T 5: 32,828,619 probably null Het
Ptpn12 T C 5: 20,989,049 K742E possibly damaging Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Sema4c G C 1: 36,553,723 T138S probably benign Het
Slc4a2 C T 5: 24,430,101 T168M probably benign Het
Spice1 G T 16: 44,357,869 S85I probably damaging Het
Thrb T A 14: 17,963,214 I59N probably damaging Het
Trav7-1 A G 14: 52,655,299 D103G probably damaging Het
Ubap2l G T 3: 90,015,451 T766N unknown Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp704 A G 3: 9,474,525 V255A probably damaging Het
Zfp759 T C 13: 67,138,967 V194A probably benign Het
Other mutations in Lrfn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Lrfn1 APN 7 28460017 missense probably damaging 1.00
IGL01565:Lrfn1 APN 7 28458769 missense probably damaging 1.00
IGL01622:Lrfn1 APN 7 28466686 missense probably damaging 1.00
IGL01623:Lrfn1 APN 7 28466686 missense probably damaging 1.00
IGL02176:Lrfn1 APN 7 28458686 intron probably benign
IGL02642:Lrfn1 APN 7 28458688 intron probably benign
R1123:Lrfn1 UTSW 7 28467119 missense possibly damaging 0.71
R1838:Lrfn1 UTSW 7 28459768 missense probably damaging 0.98
R3000:Lrfn1 UTSW 7 28467407 missense probably damaging 1.00
R3905:Lrfn1 UTSW 7 28466869 missense possibly damaging 0.49
R4246:Lrfn1 UTSW 7 28459942 missense probably benign 0.03
R5621:Lrfn1 UTSW 7 28466836 missense probably damaging 1.00
R6267:Lrfn1 UTSW 7 28459744 missense probably benign 0.01
R6902:Lrfn1 UTSW 7 28459813 missense probably benign 0.10
R7059:Lrfn1 UTSW 7 28466930 missense possibly damaging 0.65
R7073:Lrfn1 UTSW 7 28459972 missense possibly damaging 0.94
R7208:Lrfn1 UTSW 7 28467139 missense probably benign
R7402:Lrfn1 UTSW 7 28459522 missense probably damaging 1.00
Z1176:Lrfn1 UTSW 7 28459115
Predicted Primers PCR Primer
(F):5'- CACTGAACCTGGTTCTTCTGACATC -3'
(R):5'- CTGCACTGGCTCATGCTAAG -3'

Sequencing Primer
(F):5'- TTCTGACATCGCCACACCAGG -3'
(R):5'- CTGGAACTAAGCAAGGTC -3'
Posted On2015-02-19