Incidental Mutation 'R3498:Tmem127'
ID273644
Institutional Source Beutler Lab
Gene Symbol Tmem127
Ensembl Gene ENSMUSG00000034850
Gene Nametransmembrane protein 127
Synonyms2310003P10Rik
MMRRC Submission 040661-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3498 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location127247908-127261107 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127256120 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 36 (H36Q)
Ref Sequence ENSEMBL: ENSMUSP00000134629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035871] [ENSMUST00000174288] [ENSMUST00000174503]
Predicted Effect probably benign
Transcript: ENSMUST00000035871
AA Change: H120Q

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000035434
Gene: ENSMUSG00000034850
AA Change: H120Q

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Blast:Sec63 37 179 3e-98 BLAST
low complexity region 202 216 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174288
AA Change: H36Q

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134629
Gene: ENSMUSG00000034850
AA Change: H36Q

DomainStartEndE-ValueType
Blast:Sec63 1 95 1e-60 BLAST
low complexity region 118 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174503
SMART Domains Protein: ENSMUSP00000133701
Gene: ENSMUSG00000034850

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Blast:Sec63 37 124 8e-37 BLAST
Meta Mutation Damage Score 0.0715 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein with 3 predicted transmembrane domains. The protein is associated with a subpopulation of vesicular organelles corresponding to early endosomal structures, with the Golgi, and with lysosomes, and may participate in protein trafficking between these structures. Mutations in this gene and several other genes cause pheochromocytomas. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Aug 2010]
PHENOTYPE: Lysosomal activity and endosomal fusion mediated by Rab5 were affected in mouse embryonic fibroblasts of homozygous null mutants [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
A3galt2 T C 4: 128,755,557 F6L probably benign Het
Aurkc A G 7: 7,000,030 I175V probably damaging Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bcat1 A G 6: 145,019,342 V45A probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Ddx42 A G 11: 106,231,193 E178G possibly damaging Het
Dmpk T C 7: 19,086,381 I101T probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Fosb C T 7: 19,306,632 R161H probably damaging Het
Gm6729 T C 10: 86,540,718 noncoding transcript Het
Gnb1 T A 4: 155,555,026 N237K possibly damaging Het
Gpr35 A G 1: 92,983,391 Y275C probably damaging Het
Hmcn1 A T 1: 150,605,102 I4441N probably damaging Het
Ighe G A 12: 113,271,374 Q389* probably null Het
Kcnj11 T C 7: 46,099,602 D23G probably damaging Het
Lats2 G T 14: 57,722,466 A191E possibly damaging Het
Lyplal1 A G 1: 186,088,660 S197P possibly damaging Het
Map4 G T 9: 110,035,212 V502L probably benign Het
Mgat5 A G 1: 127,384,834 M237V possibly damaging Het
Mindy4 A G 6: 55,216,525 R68G probably benign Het
Nell1 T A 7: 50,258,179 V362E possibly damaging Het
Olfr1031 T A 2: 85,992,430 F204L probably benign Het
Olfr792 T A 10: 129,540,909 I124N probably damaging Het
P4ha2 T C 11: 54,119,253 Y279H probably benign Het
Pcid2 A G 8: 13,100,413 V13A possibly damaging Het
Polr2j T C 5: 136,122,770 I116T probably benign Het
Prdm9 A G 17: 15,562,945 probably benign Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Ptprf A T 4: 118,224,930 I1037N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Sde2 T A 1: 180,858,185 C101S probably damaging Het
Sec1 T C 7: 45,679,239 H128R probably damaging Het
Serpinb6a A T 13: 33,918,781 M253K probably damaging Het
Slc1a4 A T 11: 20,313,973 I248N probably damaging Het
Slc22a4 T G 11: 53,992,053 K328N probably benign Het
Slc24a4 A T 12: 102,234,692 K278N probably benign Het
Slc6a21 T A 7: 45,280,842 W222R probably damaging Het
Slc7a2 A G 8: 40,912,530 E466G probably benign Het
Sspo A G 6: 48,467,980 T2133A possibly damaging Het
Taco1 A G 11: 106,072,538 M172V probably benign Het
Tmem229b-ps C T 10: 53,475,127 noncoding transcript Het
Vac14 A G 8: 110,671,090 D479G probably benign Het
Vmn1r176 T A 7: 23,835,242 K162I probably benign Het
Other mutations in Tmem127
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Tmem127 APN 2 127257086 missense probably damaging 1.00
IGL02108:Tmem127 APN 2 127257106 missense probably damaging 0.98
IGL02556:Tmem127 APN 2 127256002 splice site probably null
R0070:Tmem127 UTSW 2 127257059 missense probably damaging 1.00
R0070:Tmem127 UTSW 2 127257059 missense probably damaging 1.00
R0765:Tmem127 UTSW 2 127257149 missense probably damaging 0.96
R1696:Tmem127 UTSW 2 127248707 missense probably damaging 0.98
R1827:Tmem127 UTSW 2 127256174 splice site probably null
R1828:Tmem127 UTSW 2 127256174 splice site probably null
R3684:Tmem127 UTSW 2 127248732 missense possibly damaging 0.72
R3950:Tmem127 UTSW 2 127248657 missense probably damaging 1.00
R5337:Tmem127 UTSW 2 127256145 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTACATTGCTTGCCTCAGGG -3'
(R):5'- TGTGGAGTTCTAACATTCCCTC -3'

Sequencing Primer
(F):5'- GATTTCTGCATGAACCCC -3'
(R):5'- CTGGGCAAGTTACTCACAAATG -3'
Posted On2015-04-02