Incidental Mutation 'R3498:Aurkc'
ID 273654
Institutional Source Beutler Lab
Gene Symbol Aurkc
Ensembl Gene ENSMUSG00000070837
Gene Name aurora kinase C
Synonyms IAK3, AIK3, Stk13, AIE1
MMRRC Submission 040661-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3498 (G1)
Quality Score 141
Status Validated
Chromosome 7
Chromosomal Location 6995300-7003091 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 7000030 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 175 (I175V)
Ref Sequence ENSEMBL: ENSMUSP00000083426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086248] [ENSMUST00000207660] [ENSMUST00000207711] [ENSMUST00000208049] [ENSMUST00000208518]
AlphaFold O88445
Predicted Effect probably damaging
Transcript: ENSMUST00000086248
AA Change: I175V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083426
Gene: ENSMUSG00000070837
AA Change: I175V

DomainStartEndE-ValueType
S_TKc 55 305 1.39e-95 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000207660
AA Change: I44V

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000207711
AA Change: I136V

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000208049
AA Change: I136V

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208518
AA Change: I136V

PolyPhen 2 Score 0.474 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.3724 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Aurora subfamily of serine/threonine protein kinases. The encoded protein is a chromosomal passenger protein that forms complexes with Aurora-B and inner centromere proteins and may play a role in organizing microtubules in relation to centrosome/spindle function during mitosis. This gene is overexpressed in several cancer cell lines, suggesting an involvement in oncogenic signal transduction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele are viable but subfertile, as shown by reduced litter sizes or failure to produce a litter. Observed sperm abnormalities include heterogeneous chromatin condensation, loose acrosomes, and blunted heads. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
A3galt2 T C 4: 128,755,557 F6L probably benign Het
Azi2 A G 9: 118,049,407 D105G probably damaging Het
Bcat1 A G 6: 145,019,342 V45A probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Ddx42 A G 11: 106,231,193 E178G possibly damaging Het
Dmpk T C 7: 19,086,381 I101T probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Fosb C T 7: 19,306,632 R161H probably damaging Het
Gm6729 T C 10: 86,540,718 noncoding transcript Het
Gnb1 T A 4: 155,555,026 N237K possibly damaging Het
Gpr35 A G 1: 92,983,391 Y275C probably damaging Het
Hmcn1 A T 1: 150,605,102 I4441N probably damaging Het
Ighe G A 12: 113,271,374 Q389* probably null Het
Kcnj11 T C 7: 46,099,602 D23G probably damaging Het
Lats2 G T 14: 57,722,466 A191E possibly damaging Het
Lyplal1 A G 1: 186,088,660 S197P possibly damaging Het
Map4 G T 9: 110,035,212 V502L probably benign Het
Mgat5 A G 1: 127,384,834 M237V possibly damaging Het
Mindy4 A G 6: 55,216,525 R68G probably benign Het
Nell1 T A 7: 50,258,179 V362E possibly damaging Het
Olfr1031 T A 2: 85,992,430 F204L probably benign Het
Olfr792 T A 10: 129,540,909 I124N probably damaging Het
P4ha2 T C 11: 54,119,253 Y279H probably benign Het
Pcid2 A G 8: 13,100,413 V13A possibly damaging Het
Polr2j T C 5: 136,122,770 I116T probably benign Het
Prdm9 A G 17: 15,562,945 probably benign Het
Prr5 T A 15: 84,703,144 V365E probably benign Het
Ptprf A T 4: 118,224,930 I1037N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Sde2 T A 1: 180,858,185 C101S probably damaging Het
Sec1 T C 7: 45,679,239 H128R probably damaging Het
Serpinb6a A T 13: 33,918,781 M253K probably damaging Het
Slc1a4 A T 11: 20,313,973 I248N probably damaging Het
Slc22a4 T G 11: 53,992,053 K328N probably benign Het
Slc24a4 A T 12: 102,234,692 K278N probably benign Het
Slc6a21 T A 7: 45,280,842 W222R probably damaging Het
Slc7a2 A G 8: 40,912,530 E466G probably benign Het
Sspo A G 6: 48,467,980 T2133A possibly damaging Het
Taco1 A G 11: 106,072,538 M172V probably benign Het
Tmem127 T A 2: 127,256,120 H36Q probably benign Het
Tmem229b-ps C T 10: 53,475,127 noncoding transcript Het
Vac14 A G 8: 110,671,090 D479G probably benign Het
Vmn1r176 T A 7: 23,835,242 K162I probably benign Het
Other mutations in Aurkc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Aurkc APN 7 6996548 missense probably damaging 1.00
IGL00896:Aurkc APN 7 7002514 missense possibly damaging 0.61
R0282:Aurkc UTSW 7 7002428 splice site probably null
R0615:Aurkc UTSW 7 7002403 missense possibly damaging 0.82
R3607:Aurkc UTSW 7 7002860 missense probably damaging 1.00
R4682:Aurkc UTSW 7 6995539 missense probably null 0.00
R5739:Aurkc UTSW 7 7002860 missense probably benign 0.01
R7592:Aurkc UTSW 7 7000007 missense probably benign 0.01
R8483:Aurkc UTSW 7 6996665 nonsense probably null
R8933:Aurkc UTSW 7 7002797 missense possibly damaging 0.92
R9003:Aurkc UTSW 7 6996548 missense probably damaging 1.00
X0025:Aurkc UTSW 7 6995528 splice site probably null
Z1176:Aurkc UTSW 7 6995514 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATGCTTCCCATTGCTGTGTG -3'
(R):5'- TAACCCCAAAGCCCAGTTTG -3'

Sequencing Primer
(F):5'- TCCCATTGCTGTGTGTACAC -3'
(R):5'- CCAAAGCCCAGTTTGTATCTG -3'
Posted On 2015-04-02