Mutagenetix > Incidental Mutation

Incidental Mutation 'R3498:Slc6a21'

273658

Institutional Source

Beutler Lab

Gene Symbol

Slc6a21

Ensembl Gene

ENSMUSG00000070568

Gene Name

solute carrier family 6 member 21

Synonyms

1700039E15Rik

MMRRC Submission

040661-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.062) question?

Stock #

R3498 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

45277513-45288998 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 45280842 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 222 (W222R)

Ref Sequence

ENSEMBL: ENSMUSP00000147890 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085364] [ENSMUST00000210861]

AlphaFold

A0A1B0GSD2

Predicted Effect

probably benign
Transcript: ENSMUST00000085364

SMART Domains

Protein: ENSMUSP00000082476
Gene: ENSMUSG00000070568

Domain	Start	End	E-Value	Type
Pfam:SNF	1	306	8.3e-37	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000176276
AA Change: W222R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000135707
Gene: ENSMUSG00000070568
AA Change: W222R

Domain	Start	End	E-Value	Type
Pfam:SNF	48	631	2e-103	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209477

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209886

Predicted Effect

probably benign
Transcript: ENSMUST00000210207

Predicted Effect

probably damaging
Transcript: ENSMUST00000210861
AA Change: W222R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

100% (43/43)

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	AC	A	17: 47,433,423		probably benign	Het
A3galt2	T	C	4: 128,755,557	F6L	probably benign	Het
Aurkc	A	G	7: 7,000,030	I175V	probably damaging	Het
Azi2	A	G	9: 118,049,407	D105G	probably damaging	Het
Bcat1	A	G	6: 145,019,342	V45A	probably damaging	Het
Cass4	C	T	2: 172,432,558	P753L	probably damaging	Het
Ddx42	A	G	11: 106,231,193	E178G	possibly damaging	Het
Dmpk	T	C	7: 19,086,381	I101T	probably damaging	Het
Dnah17	C	T	11: 118,080,849		probably benign	Het
Fosb	C	T	7: 19,306,632	R161H	probably damaging	Het
Gm6729	T	C	10: 86,540,718		noncoding transcript	Het
Gnb1	T	A	4: 155,555,026	N237K	possibly damaging	Het
Gpr35	A	G	1: 92,983,391	Y275C	probably damaging	Het
Hmcn1	A	T	1: 150,605,102	I4441N	probably damaging	Het
Ighe	G	A	12: 113,271,374	Q389*	probably null	Het
Kcnj11	T	C	7: 46,099,602	D23G	probably damaging	Het
Lats2	G	T	14: 57,722,466	A191E	possibly damaging	Het
Lyplal1	A	G	1: 186,088,660	S197P	possibly damaging	Het
Map4	G	T	9: 110,035,212	V502L	probably benign	Het
Mgat5	A	G	1: 127,384,834	M237V	possibly damaging	Het
Mindy4	A	G	6: 55,216,525	R68G	probably benign	Het
Nell1	T	A	7: 50,258,179	V362E	possibly damaging	Het
Olfr1031	T	A	2: 85,992,430	F204L	probably benign	Het
Olfr792	T	A	10: 129,540,909	I124N	probably damaging	Het
P4ha2	T	C	11: 54,119,253	Y279H	probably benign	Het
Pcid2	A	G	8: 13,100,413	V13A	possibly damaging	Het
Polr2j	T	C	5: 136,122,770	I116T	probably benign	Het
Prdm9	A	G	17: 15,562,945		probably benign	Het
Prr5	T	A	15: 84,703,144	V365E	probably benign	Het
Ptprf	A	T	4: 118,224,930	I1037N	probably damaging	Het
Ranbp17	GCCTGGATACTGACC	GCC	11: 33,219,203		probably benign	Het
Sde2	T	A	1: 180,858,185	C101S	probably damaging	Het
Sec1	T	C	7: 45,679,239	H128R	probably damaging	Het
Serpinb6a	A	T	13: 33,918,781	M253K	probably damaging	Het
Slc1a4	A	T	11: 20,313,973	I248N	probably damaging	Het
Slc22a4	T	G	11: 53,992,053	K328N	probably benign	Het
Slc24a4	A	T	12: 102,234,692	K278N	probably benign	Het
Slc7a2	A	G	8: 40,912,530	E466G	probably benign	Het
Sspo	A	G	6: 48,467,980	T2133A	possibly damaging	Het
Taco1	A	G	11: 106,072,538	M172V	probably benign	Het
Tmem127	T	A	2: 127,256,120	H36Q	probably benign	Het
Tmem229b-ps	C	T	10: 53,475,127		noncoding transcript	Het
Vac14	A	G	8: 110,671,090	D479G	probably benign	Het
Vmn1r176	T	A	7: 23,835,242	K162I	probably benign	Het

Other mutations in Slc6a21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00966:Slc6a21	APN	7	45288244	missense	probably benign	0.31
IGL01526:Slc6a21	APN	7	45287796	missense	probably damaging	1.00
IGL01670:Slc6a21	APN	7	45288133	missense	possibly damaging	0.91
IGL01975:Slc6a21	APN	7	45287851	missense	probably benign	0.28
IGL02064:Slc6a21	APN	7	45286459	missense	possibly damaging	0.71
IGL02441:Slc6a21	APN	7	45288081	missense	probably damaging	1.00
IGL02735:Slc6a21	APN	7	45286637	splice site	probably benign
IGL03097:Slc6a21	UTSW	7	45288168	nonsense	probably null
R0211:Slc6a21	UTSW	7	45288243	missense	possibly damaging	0.90
R0211:Slc6a21	UTSW	7	45288243	missense	possibly damaging	0.90
R0269:Slc6a21	UTSW	7	45286908	nonsense	probably null
R0336:Slc6a21	UTSW	7	45286468	missense	probably damaging	1.00
R1077:Slc6a21	UTSW	7	45288202	missense	probably benign	0.42
R1476:Slc6a21	UTSW	7	45272628	missense	probably benign	0.09
R1763:Slc6a21	UTSW	7	45287734	nonsense	probably null
R1792:Slc6a21	UTSW	7	45280731	missense	probably benign	0.04
R1796:Slc6a21	UTSW	7	45280755	missense	probably damaging	1.00
R1812:Slc6a21	UTSW	7	45282947	missense	probably damaging	1.00
R1868:Slc6a21	UTSW	7	45287828	missense	probably benign	0.13
R2121:Slc6a21	UTSW	7	45288462	missense	probably benign	0.04
R2129:Slc6a21	UTSW	7	45282773	splice site	probably null
R2294:Slc6a21	UTSW	7	45280528	missense	possibly damaging	0.83
R2295:Slc6a21	UTSW	7	45280528	missense	possibly damaging	0.83
R2409:Slc6a21	UTSW	7	45280326	missense	probably benign	0.15
R2858:Slc6a21	UTSW	7	45280528	missense	possibly damaging	0.83
R3751:Slc6a21	UTSW	7	45280504	missense	probably benign
R4297:Slc6a21	UTSW	7	45287762	missense	possibly damaging	0.95
R4510:Slc6a21	UTSW	7	45287289	missense	probably damaging	1.00
R4511:Slc6a21	UTSW	7	45287289	missense	probably damaging	1.00
R4876:Slc6a21	UTSW	7	45280111	nonsense	probably null
R4921:Slc6a21	UTSW	7	45288310	missense	possibly damaging	0.53
R5485:Slc6a21	UTSW	7	45282542	critical splice donor site	probably null
R5559:Slc6a21	UTSW	7	45288429	missense	possibly damaging	0.61
R6305:Slc6a21	UTSW	7	45280604	missense	possibly damaging	0.88
R6390:Slc6a21	UTSW	7	45287002	missense	probably benign	0.02
R6571:Slc6a21	UTSW	7	45280879	missense	probably damaging	0.99
R6792:Slc6a21	UTSW	7	45279885	start codon destroyed	probably null	0.02
R7235:Slc6a21	UTSW	7	45280758	missense	probably damaging	0.99
R7278:Slc6a21	UTSW	7	45282480	missense	possibly damaging	0.84
R7808:Slc6a21	UTSW	7	45282936	missense
R9047:Slc6a21	UTSW	7	45286974	missense
R9127:Slc6a21	UTSW	7	45280250	splice site	probably benign
R9299:Slc6a21	UTSW	7	45287706	missense
R9524:Slc6a21	UTSW	7	45288361	missense	probably benign
R9640:Slc6a21	UTSW	7	45287765	missense
R9748:Slc6a21	UTSW	7	45280517	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTGTGAGATGGCCTGTAAG -3'
(R):5'- ACCCAGGGTCTGTTTAGGAG -3'

Sequencing Primer
(F):5'- GCCTGTAAGTGTCTGGACCTC -3'
(R):5'- CTGCATAGTGATGGTGACCAG -3'

Posted On

2015-04-02