Incidental Mutation 'R3812:Ccdc150'
ID274091
Institutional Source Beutler Lab
Gene Symbol Ccdc150
Ensembl Gene ENSMUSG00000025983
Gene Namecoiled-coil domain containing 150
Synonyms4930511H11Rik
MMRRC Submission 040768-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R3812 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location54250683-54368727 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54368310 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1082 (M1082V)
Ref Sequence ENSEMBL: ENSMUSP00000027128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027128] [ENSMUST00000160472]
Predicted Effect probably benign
Transcript: ENSMUST00000027128
AA Change: M1082V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027128
Gene: ENSMUSG00000025983
AA Change: M1082V

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 676 N/A INTRINSIC
coiled coil region 727 952 N/A INTRINSIC
coiled coil region 985 1048 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159682
Predicted Effect probably benign
Transcript: ENSMUST00000160472
SMART Domains Protein: ENSMUSP00000125195
Gene: ENSMUSG00000025983

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 551 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163072
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (28/28)
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 T C 15: 96,289,086 V73A probably benign Het
Bpifb2 T A 2: 153,891,951 D404E probably benign Het
Cyp4a31 T C 4: 115,566,509 S137P probably benign Het
Cyp4f15 A G 17: 32,686,177 I45V probably benign Het
Fbxw28 C A 9: 109,338,530 C53F possibly damaging Het
Galntl5 T C 5: 25,186,180 F26L probably benign Het
Gm9637 A T 14: 19,402,398 noncoding transcript Het
Lcmt2 G A 2: 121,138,706 A632V probably benign Het
Metap2 A T 10: 93,870,164 L252* probably null Het
Myo1a A G 10: 127,707,415 N180S possibly damaging Het
Nlrp4a T C 7: 26,449,693 W242R probably benign Het
Olfr1143 C T 2: 87,803,052 S221F possibly damaging Het
Olfr1152 T A 2: 87,868,401 S137T probably damaging Het
Olfr1255 T A 2: 89,817,051 S242T probably damaging Het
Otogl A G 10: 107,899,471 Y151H probably damaging Het
Pkd1 T C 17: 24,565,641 V387A probably benign Het
Polm A G 11: 5,829,512 F429L possibly damaging Het
Sco2 T C 15: 89,373,679 probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sorbs2 A G 8: 45,763,030 T105A probably benign Het
Syt10 A T 15: 89,790,797 C449S probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Txndc5 T C 13: 38,523,405 K99E probably benign Het
Usp34 T A 11: 23,464,517 F2820Y possibly damaging Het
Vmn1r170 T C 7: 23,606,292 S40P probably damaging Het
Zfp292 A T 4: 34,810,326 L906Q probably damaging Het
Other mutations in Ccdc150
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00712:Ccdc150 APN 1 54272550 splice site probably benign
IGL00819:Ccdc150 APN 1 54263573 missense probably damaging 1.00
IGL01973:Ccdc150 APN 1 54300488 splice site probably null
IGL02352:Ccdc150 APN 1 54272521 missense probably benign 0.25
IGL02359:Ccdc150 APN 1 54272521 missense probably benign 0.25
IGL02620:Ccdc150 APN 1 54263545 nonsense probably null
IGL02673:Ccdc150 APN 1 54328990 missense probably benign 0.09
IGL03148:Ccdc150 APN 1 54278715 missense possibly damaging 0.68
IGL03185:Ccdc150 APN 1 54300323 missense probably damaging 1.00
IGL03014:Ccdc150 UTSW 1 54290702 missense probably damaging 0.99
R0066:Ccdc150 UTSW 1 54356691 missense probably benign
R0066:Ccdc150 UTSW 1 54356691 missense probably benign
R0217:Ccdc150 UTSW 1 54300430 missense possibly damaging 0.87
R0582:Ccdc150 UTSW 1 54329511 missense probably benign
R0687:Ccdc150 UTSW 1 54285631 splice site probably null
R0790:Ccdc150 UTSW 1 54277776 splice site probably benign
R1146:Ccdc150 UTSW 1 54364971 splice site probably benign
R1288:Ccdc150 UTSW 1 54364458 missense probably damaging 1.00
R1763:Ccdc150 UTSW 1 54354636 missense probably benign 0.42
R1855:Ccdc150 UTSW 1 54367910 intron probably benign
R1957:Ccdc150 UTSW 1 54263909 missense probably benign 0.00
R2180:Ccdc150 UTSW 1 54272547 critical splice donor site probably null
R2226:Ccdc150 UTSW 1 54364925 missense probably null 0.11
R3054:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3055:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3056:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3409:Ccdc150 UTSW 1 54356773 missense probably benign 0.02
R3411:Ccdc150 UTSW 1 54356773 missense probably benign 0.02
R4031:Ccdc150 UTSW 1 54278811 missense probably benign 0.31
R4356:Ccdc150 UTSW 1 54353054 missense probably damaging 0.98
R4617:Ccdc150 UTSW 1 54355754 missense probably benign 0.00
R4757:Ccdc150 UTSW 1 54278715 missense possibly damaging 0.81
R4957:Ccdc150 UTSW 1 54364868 intron probably benign
R5028:Ccdc150 UTSW 1 54263477 missense probably benign 0.01
R5512:Ccdc150 UTSW 1 54354647 missense probably damaging 0.96
R5757:Ccdc150 UTSW 1 54263620 missense probably damaging 1.00
R5943:Ccdc150 UTSW 1 54300367 missense probably benign 0.01
R5948:Ccdc150 UTSW 1 54277714 missense possibly damaging 0.79
R6033:Ccdc150 UTSW 1 54285628 critical splice donor site probably null
R6033:Ccdc150 UTSW 1 54285628 critical splice donor site probably null
R6065:Ccdc150 UTSW 1 54263599 missense possibly damaging 0.90
R6390:Ccdc150 UTSW 1 54368017 missense probably benign 0.01
R6399:Ccdc150 UTSW 1 54263957 splice site probably null
R6988:Ccdc150 UTSW 1 54355709 nonsense probably null
R7248:Ccdc150 UTSW 1 54304898 missense probably benign 0.00
R7319:Ccdc150 UTSW 1 54263337 intron probably null
R7322:Ccdc150 UTSW 1 54259966 missense probably benign 0.01
R7366:Ccdc150 UTSW 1 54300382 nonsense probably null
R7647:Ccdc150 UTSW 1 54356704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCGACAACTGCTGGGAAAC -3'
(R):5'- CAAAGAGATGGGTTGGTTCTGC -3'

Sequencing Primer
(F):5'- GCAACAGGCTCTAAACACT -3'
(R):5'- AGCACACATCATGGTCTTCTAACG -3'
Posted On2015-04-02