Incidental Mutation 'R3808:Sh2d3c'
ID275017
Institutional Source Beutler Lab
Gene Symbol Sh2d3c
Ensembl Gene ENSMUSG00000059013
Gene NameSH2 domain containing 3C
SynonymsChat, Cas/HEF1-associated signal transducer, Nsp3, Shep1, SH2-containing Eph receptor-binding protein 1
MMRRC Submission 040765-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3808 (G1)
Quality Score177
Status Not validated
Chromosome2
Chromosomal Location32721055-32755512 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32746096 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 159 (Y159H)
Ref Sequence ENSEMBL: ENSMUSP00000108868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074248] [ENSMUST00000113242]
Predicted Effect probably benign
Transcript: ENSMUST00000074248
AA Change: Y311H

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000073866
Gene: ENSMUSG00000059013
AA Change: Y311H

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
low complexity region 22 43 N/A INTRINSIC
low complexity region 86 98 N/A INTRINSIC
low complexity region 117 132 N/A INTRINSIC
low complexity region 190 207 N/A INTRINSIC
SH2 213 301 7.8e-21 SMART
low complexity region 333 348 N/A INTRINSIC
low complexity region 400 415 N/A INTRINSIC
low complexity region 422 436 N/A INTRINSIC
low complexity region 474 487 N/A INTRINSIC
RasGEF 576 849 8.18e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113242
AA Change: Y159H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108868
Gene: ENSMUSG00000059013
AA Change: Y159H

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
SH2 61 149 7.8e-21 SMART
low complexity region 181 196 N/A INTRINSIC
low complexity region 248 263 N/A INTRINSIC
low complexity region 270 284 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
RasGEF 424 697 8.18e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131101
SMART Domains Protein: ENSMUSP00000122613
Gene: ENSMUSG00000059013

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
low complexity region 37 54 N/A INTRINSIC
SH2 60 148 7.8e-21 SMART
low complexity region 180 195 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141670
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein and member of a cytoplasmic protein family involved in cell migration. The encoded protein contains a putative Src homology 2 (SH2) domain and guanine nucleotide exchange factor-like domain which allows this signaling protein to form a complex with scaffolding protein Crk-associated substrate. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality with absence of gastric milk. Surviving mice exhibit abnormal olfactory bulb innervation, fewer gonadotrophin positive cells in the hypothalamus, and decreased testes size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aldh3a2 G T 11: 61,258,797 L248M probably damaging Het
Als2 A G 1: 59,170,450 S1458P probably benign Het
Arhgap5 A G 12: 52,567,187 E192G possibly damaging Het
Atg2a A G 19: 6,252,816 K1019R possibly damaging Het
Atp2b1 A G 10: 99,003,148 K613E possibly damaging Het
Carm1 T C 9: 21,586,962 C421R probably damaging Het
Cdh17 A T 4: 11,795,671 Y417F probably damaging Het
Cers1 A G 8: 70,330,010 D10G possibly damaging Het
Clptm1l A C 13: 73,612,454 M319L probably benign Het
Cntnap3 A G 13: 64,781,804 V527A probably damaging Het
Creb3l2 A G 6: 37,355,690 S290P probably damaging Het
D3Ertd254e T G 3: 36,165,643 probably null Het
Dock4 T G 12: 40,672,810 V305G probably damaging Het
Dtl A C 1: 191,548,354 L356R probably damaging Het
Eftud2 A T 11: 102,841,463 probably null Het
Eif2b4 A G 5: 31,191,168 S88P possibly damaging Het
Fat4 T G 3: 38,982,438 V3413G possibly damaging Het
Fgfr2 T C 7: 130,199,848 M218V probably benign Het
Grin2b A G 6: 135,923,271 L204P probably damaging Het
Kcnj12 A G 11: 61,070,277 N467S probably benign Het
Klhdc3 T A 17: 46,677,932 N111Y possibly damaging Het
Lin9 A G 1: 180,659,111 I81V probably null Het
Lrp2 T C 2: 69,501,548 D1621G probably damaging Het
Lrp4 T A 2: 91,476,702 D389E probably damaging Het
Med15 C T 16: 17,655,734 probably benign Het
Nbea T C 3: 55,717,848 N2274S probably benign Het
Nr3c2 G A 8: 76,908,714 G148D probably damaging Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr127 T C 17: 37,903,573 V9A probably benign Het
Olfr982 A T 9: 40,074,309 M5L probably benign Het
Paxip1 A G 5: 27,772,029 probably benign Het
Pfas T C 11: 68,989,953 probably benign Het
Plin3 C A 17: 56,286,275 A96S probably damaging Het
Pnck T A X: 73,656,944 I288F probably damaging Het
Ppp4c C T 7: 126,787,327 G166D probably damaging Het
Prss43 A T 9: 110,827,772 R115S probably damaging Het
Rassf2 T C 2: 131,998,260 probably null Het
Rdh16f1 T A 10: 127,788,699 D135E probably benign Het
Rdh16f1 G A 10: 127,788,700 V136M probably damaging Het
Rgs12 A G 5: 35,032,354 E702G probably damaging Het
Rnf213 A G 11: 119,479,558 K4728E probably damaging Het
Ros1 T G 10: 52,120,848 T1243P probably benign Het
Sall1 G A 8: 89,031,473 Q668* probably null Het
Sbf2 C A 7: 110,489,280 *45L probably null Het
Serpina3j A T 12: 104,319,827 I414F probably benign Het
Slamf1 A G 1: 171,798,177 D307G probably null Het
Slc22a13 T C 9: 119,196,077 T178A probably benign Het
Smchd1 A T 17: 71,429,541 L588H probably damaging Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Vil1 T C 1: 74,427,613 V654A probably benign Het
Vmn1r202 T C 13: 22,501,900 T116A possibly damaging Het
Zfp607a G A 7: 27,879,401 R632H probably benign Het
Other mutations in Sh2d3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Sh2d3c APN 2 32725084 missense probably benign 0.00
IGL02326:Sh2d3c APN 2 32749151 critical splice acceptor site probably null
IGL03325:Sh2d3c APN 2 32725258 missense probably benign 0.00
R0008:Sh2d3c UTSW 2 32753021 missense probably damaging 1.00
R0564:Sh2d3c UTSW 2 32753052 missense probably damaging 0.99
R0619:Sh2d3c UTSW 2 32753025 missense probably damaging 1.00
R1138:Sh2d3c UTSW 2 32749405 missense probably benign 0.00
R1984:Sh2d3c UTSW 2 32749244 nonsense probably null
R4399:Sh2d3c UTSW 2 32746160 missense probably damaging 0.97
R4556:Sh2d3c UTSW 2 32753009 missense possibly damaging 0.81
R4840:Sh2d3c UTSW 2 32721160 start codon destroyed probably null 0.02
R5027:Sh2d3c UTSW 2 32744802 missense possibly damaging 0.95
R5367:Sh2d3c UTSW 2 32745902 missense probably damaging 1.00
R6754:Sh2d3c UTSW 2 32754530 missense probably damaging 1.00
R6916:Sh2d3c UTSW 2 32752653 nonsense probably null
R7029:Sh2d3c UTSW 2 32754569 makesense probably null
R7047:Sh2d3c UTSW 2 32721160 start codon destroyed probably null 0.02
R7636:Sh2d3c UTSW 2 32725011 missense probably benign 0.17
R7893:Sh2d3c UTSW 2 32749376 nonsense probably null
R8072:Sh2d3c UTSW 2 32753138 missense probably damaging 1.00
R8115:Sh2d3c UTSW 2 32725264 missense probably benign 0.12
R8447:Sh2d3c UTSW 2 32752659 missense probably damaging 1.00
R8553:Sh2d3c UTSW 2 32745913 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAATCAGGCCTTGCACTTC -3'
(R):5'- TTCATTAACAAGCCAGAGGGAAGTG -3'

Sequencing Primer
(F):5'- TTGCACTTCAAGATCAACAAGGTGG -3'
(R):5'- AAGTGGGGATCTGGCTGACC -3'
Posted On2015-04-02