Mutagenetix > Incidental Mutations

Incidental Mutation 'R3808:Sbf2'

275035

Institutional Source

Beutler Lab

Gene Symbol

Sbf2

Ensembl Gene

ENSMUSG00000038371

Gene Name

SET binding factor 2

Synonyms

mMTMH1, 4833411B01Rik, Mtmr13, B430219L04Rik, SBF2

MMRRC Submission

040765-MU

Accession Numbers

Genbank: NM_177324; MGI: 1921831

Is this an essential gene?

Possibly non essential (E-score: 0.372) question?

Stock #

R3808 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110308013-110614922 bp(-) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

C to A at 110489280 bp

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Leucine at position 45 (*45L)

Ref Sequence

ENSEMBL: ENSMUSP00000127105 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033058] [ENSMUST00000164759] [ENSMUST00000166020] [ENSMUST00000167652] [ENSMUST00000171218]

Predicted Effect

probably damaging
Transcript: ENSMUST00000033058
AA Change: D75Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000033058
Gene: ENSMUSG00000038371
AA Change: D75Y

Domain	Start	End	E-Value	Type
uDENN	1	87	2.27e-33	SMART
DENN	116	298	5.68e-75	SMART
dDENN	351	420	2e-20	SMART
Pfam:SBF2	530	752	3.3e-106	PFAM
GRAM	869	955	1.3e-12	SMART
low complexity region	1078	1089	N/A	INTRINSIC
Pfam:Myotub-related	1091	1544	8.3e-86	PFAM
PH	1767	1872	3.05e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000164759
AA Change: D75Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132072
Gene: ENSMUSG00000038371
AA Change: D75Y

Domain	Start	End	E-Value	Type
uDENN	1	87	2.27e-33	SMART
DENN	116	298	5.68e-75	SMART
dDENN	351	420	2e-20	SMART
Pfam:SBF2	528	752	1.6e-107	PFAM
GRAM	869	955	1.3e-12	SMART
Pfam:Myotub-related	1089	1521	1.6e-98	PFAM
PH	1742	1847	3.05e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165449

Predicted Effect

probably benign
Transcript: ENSMUST00000166020

SMART Domains

Protein: ENSMUSP00000126217
Gene: ENSMUSG00000038371

Domain	Start	End	E-Value	Type
uDENN	1	75	9.26e-1	SMART
DENN	70	252	5.68e-75	SMART
dDENN	305	374	2e-20	SMART
Pfam:SBF2	482	706	1.6e-107	PFAM
GRAM	823	909	1.3e-12	SMART
Pfam:Myotub-related	1043	1500	5.9e-98	PFAM
PH	1721	1826	3.05e-18	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000167652
AA Change: *45L

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167880

Predicted Effect

probably benign
Transcript: ENSMUST00000171218
AA Change: D75Y

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000129805
Gene: ENSMUSG00000038371
AA Change: D75Y

Domain	Start	End	E-Value	Type
uDENN	1	87	2.27e-33	SMART
DENN	116	298	5.68e-75	SMART
dDENN	351	407	1.5e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171378

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pseudophosphatase and member of the myotubularin-related protein family. This gene maps within the CMT4B2 candidate region of chromosome 11p15 and mutations in this gene have been associated with Charcot-Marie-Tooth Disease, type 4B2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null alleles display progressive misfolding of myelin sheaths and abnormal nerve electrophysiology. [provided by MGI curators]

Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Aldh3a2	G	T	11: 61,258,797	L248M	probably damaging	Het
Als2	A	G	1: 59,170,450	S1458P	probably benign	Het
Arhgap5	A	G	12: 52,567,187	E192G	possibly damaging	Het
Atg2a	A	G	19: 6,252,816	K1019R	possibly damaging	Het
Atp2b1	A	G	10: 99,003,148	K613E	possibly damaging	Het
Carm1	T	C	9: 21,586,962	C421R	probably damaging	Het
Cdh17	A	T	4: 11,795,671	Y417F	probably damaging	Het
Cers1	A	G	8: 70,330,010	D10G	possibly damaging	Het
Clptm1l	A	C	13: 73,612,454	M319L	probably benign	Het
Cntnap3	A	G	13: 64,781,804	V527A	probably damaging	Het
Creb3l2	A	G	6: 37,355,690	S290P	probably damaging	Het
D3Ertd254e	T	G	3: 36,165,643		probably null	Het
Dock4	T	G	12: 40,672,810	V305G	probably damaging	Het
Dtl	A	C	1: 191,548,354	L356R	probably damaging	Het
Eftud2	A	T	11: 102,841,463		probably null	Het
Eif2b4	A	G	5: 31,191,168	S88P	possibly damaging	Het
Fat4	T	G	3: 38,982,438	V3413G	possibly damaging	Het
Fgfr2	T	C	7: 130,199,848	M218V	probably benign	Het
Grin2b	A	G	6: 135,923,271	L204P	probably damaging	Het
Kcnj12	A	G	11: 61,070,277	N467S	probably benign	Het
Klhdc3	T	A	17: 46,677,932	N111Y	possibly damaging	Het
Lin9	A	G	1: 180,659,111	I81V	probably null	Het
Lrp2	T	C	2: 69,501,548	D1621G	probably damaging	Het
Lrp4	T	A	2: 91,476,702	D389E	probably damaging	Het
Med15	C	T	16: 17,655,734		probably benign	Het
Nbea	T	C	3: 55,717,848	N2274S	probably benign	Het
Nr3c2	G	A	8: 76,908,714	G148D	probably damaging	Het
Olfr1217	G	T	2: 89,023,426	H192Q	probably benign	Het
Olfr127	T	C	17: 37,903,573	V9A	probably benign	Het
Olfr982	A	T	9: 40,074,309	M5L	probably benign	Het
Paxip1	A	G	5: 27,772,029		probably benign	Het
Pfas	T	C	11: 68,989,953		probably benign	Het
Plin3	C	A	17: 56,286,275	A96S	probably damaging	Het
Pnck	T	A	X: 73,656,944	I288F	probably damaging	Het
Ppp4c	C	T	7: 126,787,327	G166D	probably damaging	Het
Prss43	A	T	9: 110,827,772	R115S	probably damaging	Het
Rassf2	T	C	2: 131,998,260		probably null	Het
Rdh16f1	T	A	10: 127,788,699	D135E	probably benign	Het
Rdh16f1	G	A	10: 127,788,700	V136M	probably damaging	Het
Rgs12	A	G	5: 35,032,354	E702G	probably damaging	Het
Rnf213	A	G	11: 119,479,558	K4728E	probably damaging	Het
Ros1	T	G	10: 52,120,848	T1243P	probably benign	Het
Sall1	G	A	8: 89,031,473	Q668*	probably null	Het
Serpina3j	A	T	12: 104,319,827	I414F	probably benign	Het
Sh2d3c	T	C	2: 32,746,096	Y159H	probably damaging	Het
Slamf1	A	G	1: 171,798,177	D307G	probably null	Het
Slc22a13	T	C	9: 119,196,077	T178A	probably benign	Het
Smchd1	A	T	17: 71,429,541	L588H	probably damaging	Het
Svs1	C	T	6: 48,987,994	P312L	possibly damaging	Het
Trim12a	G	A	7: 104,306,994	A113V	probably benign	Het
Vil1	T	C	1: 74,427,613	V654A	probably benign	Het
Vmn1r202	T	C	13: 22,501,900	T116A	possibly damaging	Het
Zfp607a	G	A	7: 27,879,401	R632H	probably benign	Het

Other mutations in Sbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Sbf2	APN	7	110375832	splice site	probably benign
IGL01089:Sbf2	APN	7	110348962	missense	probably damaging	1.00
IGL01144:Sbf2	APN	7	110329903	missense	probably damaging	1.00
IGL01652:Sbf2	APN	7	110447120	missense	probably damaging	1.00
IGL01950:Sbf2	APN	7	110365825	missense	probably benign	0.00
IGL02027:Sbf2	APN	7	110461141	missense	probably damaging	1.00
IGL02244:Sbf2	APN	7	110560295	missense	probably damaging	1.00
IGL02376:Sbf2	APN	7	110462956	missense	probably damaging	0.99
IGL03405:Sbf2	APN	7	110462932	missense	probably damaging	0.98
N/A - 535:Sbf2	UTSW	7	110312752	missense	probably benign
R0084:Sbf2	UTSW	7	110442366	missense	possibly damaging	0.95
R0092:Sbf2	UTSW	7	110320806	splice site	probably benign
R0121:Sbf2	UTSW	7	110489219	critical splice donor site	probably null
R0464:Sbf2	UTSW	7	110464576	splice site	probably benign
R0505:Sbf2	UTSW	7	110399343	missense	probably damaging	1.00
R0531:Sbf2	UTSW	7	110367323	splice site	probably benign
R0554:Sbf2	UTSW	7	110428287	missense	probably damaging	1.00
R0617:Sbf2	UTSW	7	110330683	frame shift	probably null
R0619:Sbf2	UTSW	7	110310262	missense	possibly damaging	0.87
R0799:Sbf2	UTSW	7	110341355	missense	possibly damaging	0.58
R0898:Sbf2	UTSW	7	110371652	missense	possibly damaging	0.59
R1077:Sbf2	UTSW	7	110367172	splice site	probably benign
R1167:Sbf2	UTSW	7	110364549	missense	probably damaging	1.00
R1169:Sbf2	UTSW	7	110310184	missense	probably benign	0.04
R1424:Sbf2	UTSW	7	110315026	missense	probably damaging	1.00
R1536:Sbf2	UTSW	7	110378043	missense	probably damaging	1.00
R1558:Sbf2	UTSW	7	110428346	missense	probably damaging	1.00
R1601:Sbf2	UTSW	7	110340076	critical splice acceptor site	probably null
R1762:Sbf2	UTSW	7	110312758	missense	probably benign
R1771:Sbf2	UTSW	7	110461146	nonsense	probably null
R1989:Sbf2	UTSW	7	110348923	missense	possibly damaging	0.94
R2109:Sbf2	UTSW	7	110461212	missense	probably damaging	1.00
R2126:Sbf2	UTSW	7	110560295	missense	probably damaging	1.00
R2444:Sbf2	UTSW	7	110330698	missense	probably benign	0.31
R3765:Sbf2	UTSW	7	110375581	missense	probably damaging	1.00
R3895:Sbf2	UTSW	7	110447091	missense	probably damaging	0.99
R3978:Sbf2	UTSW	7	110329885	missense	probably benign	0.00
R4056:Sbf2	UTSW	7	110441466	missense	probably damaging	0.99
R4057:Sbf2	UTSW	7	110441466	missense	probably damaging	0.99
R4111:Sbf2	UTSW	7	110428242	missense	probably damaging	1.00
R4569:Sbf2	UTSW	7	110348853	critical splice donor site	probably null
R4670:Sbf2	UTSW	7	110335399	missense	probably damaging	1.00
R4763:Sbf2	UTSW	7	110420917	missense	probably damaging	1.00
R4792:Sbf2	UTSW	7	110351610	missense	probably damaging	0.98
R4811:Sbf2	UTSW	7	110372535	missense	probably damaging	1.00
R4822:Sbf2	UTSW	7	110377939	intron	probably benign
R5110:Sbf2	UTSW	7	110364657	missense	probably benign	0.10
R5143:Sbf2	UTSW	7	110422540	nonsense	probably null
R5443:Sbf2	UTSW	7	110377928	intron	probably benign
R5457:Sbf2	UTSW	7	110312830	missense	probably benign
R5641:Sbf2	UTSW	7	110438901	missense	probably damaging	1.00
R5915:Sbf2	UTSW	7	110378096	nonsense	probably null
R5948:Sbf2	UTSW	7	110489285	missense	probably damaging	1.00
R5977:Sbf2	UTSW	7	110377986	missense	probably benign	0.00
R6052:Sbf2	UTSW	7	110441534	missense	probably damaging	1.00
R6142:Sbf2	UTSW	7	110348975	missense	probably damaging	1.00
R6327:Sbf2	UTSW	7	110441552	missense	probably damaging	1.00
R6356:Sbf2	UTSW	7	110372623	missense	probably damaging	1.00
R6450:Sbf2	UTSW	7	110462863	missense	probably damaging	1.00
R6587:Sbf2	UTSW	7	110440975	missense	probably damaging	1.00
R6696:Sbf2	UTSW	7	110560298	missense	probably benign	0.04
R6986:Sbf2	UTSW	7	110330615	missense	probably damaging	0.99
R7147:Sbf2	UTSW	7	110447061	missense	probably benign	0.01
R7358:Sbf2	UTSW	7	110399348	missense	possibly damaging	0.95
R7414:Sbf2	UTSW	7	110314064	missense	possibly damaging	0.89
R7418:Sbf2	UTSW	7	110365821	missense	probably damaging	1.00
R7423:Sbf2	UTSW	7	110438848	missense	possibly damaging	0.48
R7425:Sbf2	UTSW	7	110375777	nonsense	probably null
R7431:Sbf2	UTSW	7	110351750	missense	probably damaging	1.00
R7497:Sbf2	UTSW	7	110614716	nonsense	probably null
R7556:Sbf2	UTSW	7	110314053	missense	probably benign	0.20
R7604:Sbf2	UTSW	7	110378067	missense	possibly damaging	0.95
R7707:Sbf2	UTSW	7	110330713	critical splice acceptor site	probably null
R7746:Sbf2	UTSW	7	110441426	missense	probably benign	0.01
R7812:Sbf2	UTSW	7	110449963	missense	possibly damaging	0.84
R7849:Sbf2	UTSW	7	110372510	missense	probably damaging	1.00
R8026:Sbf2	UTSW	7	110335387	missense	probably damaging	1.00
R8048:Sbf2	UTSW	7	110315082	missense	probably benign	0.21
R8305:Sbf2	UTSW	7	110371618	missense	possibly damaging	0.79
R8337:Sbf2	UTSW	7	110441462	missense	probably benign
RF005:Sbf2	UTSW	7	110317008	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAAGTTTGCTTCATGATAGGTAACTTG -3'
(R):5'- TGTATGTATATGGACATGTGATCACA -3'

Sequencing Primer
(F):5'- AATGCAATATGAGTTCTGGTCCTTG -3'
(R):5'- CATTGTGCTAAGATGTCAGGCACAC -3'

Posted On

2015-04-02