Incidental Mutation 'R3808:Carm1'
ID275042
Institutional Source Beutler Lab
Gene Symbol Carm1
Ensembl Gene ENSMUSG00000032185
Gene Namecoactivator-associated arginine methyltransferase 1
SynonymsPrmt4
MMRRC Submission 040765-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3808 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location21546894-21592623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21586962 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 421 (C421R)
Ref Sequence ENSEMBL: ENSMUSP00000111053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034700] [ENSMUST00000034703] [ENSMUST00000078572] [ENSMUST00000115394] [ENSMUST00000115395] [ENSMUST00000130032] [ENSMUST00000180365] [ENSMUST00000213809]
Predicted Effect probably benign
Transcript: ENSMUST00000034700
SMART Domains Protein: ENSMUSP00000034700
Gene: ENSMUSG00000032182

DomainStartEndE-ValueType
Pfam:Yip1 84 272 1.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000034703
AA Change: C421R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034703
Gene: ENSMUSG00000032185
AA Change: C421R

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2.1e-71 PFAM
Pfam:PRMT5 144 447 2.3e-16 PFAM
Pfam:MTS 166 308 2.7e-10 PFAM
Pfam:Methyltransf_9 168 318 1.1e-9 PFAM
Pfam:PrmA 173 287 2.2e-12 PFAM
Pfam:Methyltransf_31 183 325 7.4e-11 PFAM
Pfam:Methyltransf_18 185 290 5.1e-12 PFAM
Pfam:Methyltransf_26 186 287 5.3e-10 PFAM
Pfam:Methyltransf_11 190 287 8.5e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 562 576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078572
SMART Domains Protein: ENSMUSP00000077649
Gene: ENSMUSG00000032182

DomainStartEndE-ValueType
Pfam:Yip1 84 272 1.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115394
AA Change: C421R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111052
Gene: ENSMUSG00000032185
AA Change: C421R

DomainStartEndE-ValueType
Pfam:CARM1 29 140 4.7e-63 PFAM
Pfam:PRMT5 145 447 4.1e-16 PFAM
Pfam:Methyltransf_9 168 318 1.4e-9 PFAM
Pfam:MTS 170 299 2.5e-9 PFAM
Pfam:PrmA 175 287 3.7e-12 PFAM
Pfam:Methyltransf_31 183 326 1.9e-10 PFAM
Pfam:Methyltransf_18 185 290 4e-9 PFAM
Pfam:Methyltransf_11 190 287 6.5e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115395
AA Change: C421R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111053
Gene: ENSMUSG00000032185
AA Change: C421R

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2e-71 PFAM
Pfam:PRMT5 144 447 2.1e-16 PFAM
Pfam:MTS 166 308 2.6e-10 PFAM
Pfam:Methyltransf_9 168 318 1.1e-9 PFAM
Pfam:PrmA 172 287 2.1e-12 PFAM
Pfam:Methyltransf_31 183 326 6.9e-11 PFAM
Pfam:Methyltransf_18 185 290 4.8e-12 PFAM
Pfam:Methyltransf_26 186 287 5e-10 PFAM
Pfam:Methyltransf_11 190 287 8.1e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 540 553 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130032
SMART Domains Protein: ENSMUSP00000117243
Gene: ENSMUSG00000032185

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2.8e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130100
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132011
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154049
Predicted Effect probably benign
Transcript: ENSMUST00000180365
SMART Domains Protein: ENSMUSP00000136463
Gene: ENSMUSG00000032182

DomainStartEndE-ValueType
Pfam:Yip1 84 272 1.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213809
Predicted Effect probably benign
Transcript: ENSMUST00000216160
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protein arginine methyltransferase (PRMT) family. The encoded enzyme catalyzes the methylation of guanidino nitrogens of arginyl residues of proteins. The enzyme acts specifically on histones and other chromatin-associated proteins and is involved in regulation of gene expression. The enzyme may act in association with other proteins or within multi-protein complexes and may play a role in cell type-specific functions and cell lineage specification. A related pseudogene is located on chromosome 9. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null fetuses are small and die perinatally, whereas heterozygotes are born at the expected Mendelian ratio but show decreased survival through weaning. Mice homozygous for a kinase null allele exhibit neonatal lethality, arrested T cell development, and impaired adipogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Aldh3a2 G T 11: 61,258,797 L248M probably damaging Het
Als2 A G 1: 59,170,450 S1458P probably benign Het
Arhgap5 A G 12: 52,567,187 E192G possibly damaging Het
Atg2a A G 19: 6,252,816 K1019R possibly damaging Het
Atp2b1 A G 10: 99,003,148 K613E possibly damaging Het
Cdh17 A T 4: 11,795,671 Y417F probably damaging Het
Cers1 A G 8: 70,330,010 D10G possibly damaging Het
Clptm1l A C 13: 73,612,454 M319L probably benign Het
Cntnap3 A G 13: 64,781,804 V527A probably damaging Het
Creb3l2 A G 6: 37,355,690 S290P probably damaging Het
D3Ertd254e T G 3: 36,165,643 probably null Het
Dock4 T G 12: 40,672,810 V305G probably damaging Het
Dtl A C 1: 191,548,354 L356R probably damaging Het
Eftud2 A T 11: 102,841,463 probably null Het
Eif2b4 A G 5: 31,191,168 S88P possibly damaging Het
Fat4 T G 3: 38,982,438 V3413G possibly damaging Het
Fgfr2 T C 7: 130,199,848 M218V probably benign Het
Grin2b A G 6: 135,923,271 L204P probably damaging Het
Kcnj12 A G 11: 61,070,277 N467S probably benign Het
Klhdc3 T A 17: 46,677,932 N111Y possibly damaging Het
Lin9 A G 1: 180,659,111 I81V probably null Het
Lrp2 T C 2: 69,501,548 D1621G probably damaging Het
Lrp4 T A 2: 91,476,702 D389E probably damaging Het
Med15 C T 16: 17,655,734 probably benign Het
Nbea T C 3: 55,717,848 N2274S probably benign Het
Nr3c2 G A 8: 76,908,714 G148D probably damaging Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Olfr127 T C 17: 37,903,573 V9A probably benign Het
Olfr982 A T 9: 40,074,309 M5L probably benign Het
Paxip1 A G 5: 27,772,029 probably benign Het
Pfas T C 11: 68,989,953 probably benign Het
Plin3 C A 17: 56,286,275 A96S probably damaging Het
Pnck T A X: 73,656,944 I288F probably damaging Het
Ppp4c C T 7: 126,787,327 G166D probably damaging Het
Prss43 A T 9: 110,827,772 R115S probably damaging Het
Rassf2 T C 2: 131,998,260 probably null Het
Rdh16f1 T A 10: 127,788,699 D135E probably benign Het
Rdh16f1 G A 10: 127,788,700 V136M probably damaging Het
Rgs12 A G 5: 35,032,354 E702G probably damaging Het
Rnf213 A G 11: 119,479,558 K4728E probably damaging Het
Ros1 T G 10: 52,120,848 T1243P probably benign Het
Sall1 G A 8: 89,031,473 Q668* probably null Het
Sbf2 C A 7: 110,489,280 *45L probably null Het
Serpina3j A T 12: 104,319,827 I414F probably benign Het
Sh2d3c T C 2: 32,746,096 Y159H probably damaging Het
Slamf1 A G 1: 171,798,177 D307G probably null Het
Slc22a13 T C 9: 119,196,077 T178A probably benign Het
Smchd1 A T 17: 71,429,541 L588H probably damaging Het
Svs1 C T 6: 48,987,994 P312L possibly damaging Het
Trim12a G A 7: 104,306,994 A113V probably benign Het
Vil1 T C 1: 74,427,613 V654A probably benign Het
Vmn1r202 T C 13: 22,501,900 T116A possibly damaging Het
Zfp607a G A 7: 27,879,401 R632H probably benign Het
Other mutations in Carm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Carm1 APN 9 21587194 missense possibly damaging 0.62
IGL01360:Carm1 APN 9 21587302 missense probably benign 0.19
IGL01401:Carm1 APN 9 21569582 critical splice donor site probably null
IGL02218:Carm1 APN 9 21569512 missense probably damaging 1.00
IGL02436:Carm1 APN 9 21579462 missense probably damaging 1.00
IGL02601:Carm1 APN 9 21586908 missense probably damaging 1.00
R0551:Carm1 UTSW 9 21580491 splice site probably null
R0580:Carm1 UTSW 9 21583584 missense probably damaging 1.00
R0724:Carm1 UTSW 9 21587374 missense probably damaging 1.00
R0883:Carm1 UTSW 9 21569591 splice site probably benign
R1390:Carm1 UTSW 9 21579493 missense probably damaging 1.00
R1713:Carm1 UTSW 9 21586489 missense probably damaging 0.97
R1950:Carm1 UTSW 9 21574516 missense probably benign 0.01
R1960:Carm1 UTSW 9 21580310 missense probably benign 0.40
R2402:Carm1 UTSW 9 21583540 missense probably damaging 1.00
R2512:Carm1 UTSW 9 21575412 critical splice acceptor site probably null
R2520:Carm1 UTSW 9 21583597 splice site probably null
R2939:Carm1 UTSW 9 21579396 splice site probably null
R2940:Carm1 UTSW 9 21579396 splice site probably null
R3081:Carm1 UTSW 9 21579396 splice site probably null
R3407:Carm1 UTSW 9 21586182 missense probably damaging 1.00
R3434:Carm1 UTSW 9 21569473 missense probably damaging 1.00
R4504:Carm1 UTSW 9 21569526 missense probably damaging 1.00
R4700:Carm1 UTSW 9 21587184 missense probably benign 0.12
R5019:Carm1 UTSW 9 21579511 critical splice donor site probably null
R5362:Carm1 UTSW 9 21587359 missense probably benign 0.03
R5661:Carm1 UTSW 9 21586999 missense probably benign 0.10
R5730:Carm1 UTSW 9 21580340 missense probably benign 0.37
R5913:Carm1 UTSW 9 21587552 missense probably benign 0.01
R5928:Carm1 UTSW 9 21575302 intron probably benign
R6370:Carm1 UTSW 9 21587519 missense probably benign 0.11
R6431:Carm1 UTSW 9 21583077 missense probably damaging 1.00
R6555:Carm1 UTSW 9 21586962 missense probably damaging 1.00
R7177:Carm1 UTSW 9 21547027 missense unknown
R7235:Carm1 UTSW 9 21587405 critical splice donor site probably benign
R7249:Carm1 UTSW 9 21586209 missense probably benign
R7576:Carm1 UTSW 9 21586536 critical splice donor site probably null
R7650:Carm1 UTSW 9 21580372 missense probably benign 0.00
R7664:Carm1 UTSW 9 21586990 missense probably benign 0.01
R8359:Carm1 UTSW 9 21569469 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- CCCAAAGGACCATTCAGGGAAG -3'
(R):5'- CAGCAGGTTACTGGACTTGGAG -3'

Sequencing Primer
(F):5'- AAGGCCCTTGGGAATGATATC -3'
(R):5'- CCTGTGCCACAATACTGATGTCATAG -3'
Posted On2015-04-02