Incidental Mutation 'R3876:Pygl'
ID 276862
Institutional Source Beutler Lab
Gene Symbol Pygl
Ensembl Gene ENSMUSG00000021069
Gene Name liver glycogen phosphorylase
Synonyms
MMRRC Submission 041606-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.562) question?
Stock # R3876 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 70237589-70274457 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 70248113 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 250 (T250I)
Ref Sequence ENSEMBL: ENSMUSP00000125585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071250] [ENSMUST00000161083]
AlphaFold Q9ET01
Predicted Effect probably damaging
Transcript: ENSMUST00000071250
AA Change: T341I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071231
Gene: ENSMUSG00000021069
AA Change: T341I

DomainStartEndE-ValueType
Pfam:Phosphorylase 113 829 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161083
AA Change: T250I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125585
Gene: ENSMUSG00000021069
AA Change: T250I

DomainStartEndE-ValueType
Pfam:Phosphorylase 21 739 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222093
Meta Mutation Damage Score 0.9727 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homodimeric protein that catalyses the cleavage of alpha-1,4-glucosidic bonds to release glucose-1-phosphate from liver glycogen stores. This protein switches from inactive phosphorylase B to active phosphorylase A by phosphorylation of serine residue 15. Activity of this enzyme is further regulated by multiple allosteric effectors and hormonal controls. Humans have three glycogen phosphorylase genes that encode distinct isozymes that are primarily expressed in liver, brain and muscle, respectively. The liver isozyme serves the glycemic demands of the body in general while the brain and muscle isozymes supply just those tissues. In glycogen storage disease type VI, also known as Hers disease, mutations in liver glycogen phosphorylase inhibit the conversion of glycogen to glucose and results in moderate hypoglycemia, mild ketosis, growth retardation and hepatomegaly. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G A 14: 54,828,857 (GRCm39) R215* probably null Het
Brinp2 C A 1: 158,074,416 (GRCm39) L568F probably damaging Het
Brip1 T C 11: 86,043,616 (GRCm39) Y316C probably damaging Het
Cdk5rap2 ATGTG ATG 4: 70,208,214 (GRCm39) probably null Het
Cfap69 G T 5: 5,634,645 (GRCm39) probably benign Het
Chrnb4 T C 9: 54,951,182 (GRCm39) E27G probably damaging Het
Clec14a A G 12: 58,315,430 (GRCm39) V64A possibly damaging Het
Crygs A G 16: 22,625,262 (GRCm39) Y60H probably damaging Het
Dpp10 T A 1: 123,281,216 (GRCm39) Q611L probably damaging Het
Entpd1 T C 19: 40,725,264 (GRCm39) L450P probably damaging Het
Eogt G A 6: 97,097,151 (GRCm39) S317L probably damaging Het
Exosc10 T A 4: 148,657,376 (GRCm39) S584T probably benign Het
Fam184a C T 10: 53,575,157 (GRCm39) V151I probably damaging Het
Fbxo43 A G 15: 36,152,258 (GRCm39) V517A probably damaging Het
Flii T C 11: 60,610,698 (GRCm39) T533A possibly damaging Het
Frmpd1 T G 4: 45,284,093 (GRCm39) H971Q probably benign Het
Gata3 A T 2: 9,867,954 (GRCm39) N333K probably damaging Het
Hectd1 A G 12: 51,815,513 (GRCm39) S1525P probably damaging Het
Ibtk A G 9: 85,600,479 (GRCm39) I816T probably benign Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Krt34 T C 11: 99,931,791 (GRCm39) T143A probably benign Het
Lipn G T 19: 34,046,828 (GRCm39) M43I probably benign Het
Lrp1b A G 2: 41,335,206 (GRCm39) C779R probably damaging Het
Mios G A 6: 8,233,189 (GRCm39) R779Q probably damaging Het
Mme A T 3: 63,269,480 (GRCm39) probably benign Het
Ncstn A G 1: 171,897,640 (GRCm39) S418P probably benign Het
Oprk1 T A 1: 5,672,884 (GRCm39) C340* probably null Het
Or10d1c T A 9: 38,894,166 (GRCm39) Y58F probably damaging Het
Or4c29 T C 2: 88,739,952 (GRCm39) T262A possibly damaging Het
Or4k39 T C 2: 111,238,967 (GRCm39) V69A possibly damaging Het
Or6c210 C T 10: 129,496,143 (GRCm39) P156L probably benign Het
Or6z7 G A 7: 6,484,131 (GRCm39) A8V probably benign Het
Pald1 T A 10: 61,183,266 (GRCm39) N323Y probably damaging Het
Pcdhac1 C A 18: 37,224,945 (GRCm39) A586E probably damaging Het
Pcnx2 C T 8: 126,614,897 (GRCm39) A185T probably benign Het
Pik3r1 G A 13: 101,821,465 (GRCm39) H430Y probably benign Het
Polr3b G A 10: 84,556,382 (GRCm39) probably null Het
Prl8a6 A T 13: 27,617,015 (GRCm39) L225* probably null Het
Psme4 T C 11: 30,806,068 (GRCm39) S89P probably damaging Het
Rgs13 T A 1: 144,016,528 (GRCm39) K72* probably null Het
Ryr2 T A 13: 11,603,045 (GRCm39) I4514F probably damaging Het
Septin3 A T 15: 82,170,002 (GRCm39) D32V probably damaging Het
Sfrp2 C T 3: 83,674,335 (GRCm39) P163S possibly damaging Het
Spata31 A G 13: 65,068,745 (GRCm39) T298A probably benign Het
Stxbp2 T C 8: 3,683,369 (GRCm39) probably null Het
Syne1 A T 10: 5,002,345 (GRCm39) M282K possibly damaging Het
Timd2 T C 11: 46,561,847 (GRCm39) probably null Het
Tlr11 G A 14: 50,600,611 (GRCm39) V866I probably benign Het
Trappc10 T C 10: 78,056,020 (GRCm39) probably null Het
Zfp512b AG AGG 2: 181,230,556 (GRCm39) probably null Het
Other mutations in Pygl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Pygl APN 12 70,237,866 (GRCm39) missense probably damaging 1.00
IGL00903:Pygl APN 12 70,254,516 (GRCm39) missense probably damaging 1.00
IGL01965:Pygl APN 12 70,237,888 (GRCm39) missense probably benign 0.00
IGL02347:Pygl APN 12 70,248,666 (GRCm39) missense probably benign 0.14
IGL02403:Pygl APN 12 70,241,032 (GRCm39) missense probably benign
IGL02501:Pygl APN 12 70,237,908 (GRCm39) missense probably benign 0.05
IGL02727:Pygl APN 12 70,254,442 (GRCm39) splice site probably null
IGL03125:Pygl APN 12 70,244,256 (GRCm39) missense probably damaging 1.00
IGL03158:Pygl APN 12 70,242,449 (GRCm39) missense probably damaging 1.00
IGL03202:Pygl APN 12 70,246,420 (GRCm39) missense probably benign
IGL03368:Pygl APN 12 70,237,926 (GRCm39) missense probably benign
R0096:Pygl UTSW 12 70,237,940 (GRCm39) splice site probably benign
R0096:Pygl UTSW 12 70,237,940 (GRCm39) splice site probably benign
R0524:Pygl UTSW 12 70,254,498 (GRCm39) missense probably damaging 1.00
R0883:Pygl UTSW 12 70,253,178 (GRCm39) missense probably damaging 0.97
R0894:Pygl UTSW 12 70,241,148 (GRCm39) splice site probably benign
R0905:Pygl UTSW 12 70,257,791 (GRCm39) splice site probably benign
R1494:Pygl UTSW 12 70,246,504 (GRCm39) missense probably damaging 0.98
R1621:Pygl UTSW 12 70,237,866 (GRCm39) missense probably damaging 1.00
R1647:Pygl UTSW 12 70,243,784 (GRCm39) missense possibly damaging 0.60
R3082:Pygl UTSW 12 70,244,303 (GRCm39) missense probably damaging 1.00
R3845:Pygl UTSW 12 70,245,217 (GRCm39) missense probably benign 0.12
R4358:Pygl UTSW 12 70,242,464 (GRCm39) missense probably damaging 1.00
R4614:Pygl UTSW 12 70,257,753 (GRCm39) splice site probably null
R4707:Pygl UTSW 12 70,254,532 (GRCm39) missense possibly damaging 0.69
R4908:Pygl UTSW 12 70,243,807 (GRCm39) missense probably null
R4940:Pygl UTSW 12 70,253,155 (GRCm39) missense probably damaging 1.00
R5077:Pygl UTSW 12 70,248,666 (GRCm39) missense probably benign 0.14
R5186:Pygl UTSW 12 70,248,118 (GRCm39) missense probably damaging 1.00
R5726:Pygl UTSW 12 70,237,916 (GRCm39) nonsense probably null
R5953:Pygl UTSW 12 70,266,401 (GRCm39) missense probably damaging 1.00
R5957:Pygl UTSW 12 70,246,494 (GRCm39) missense probably damaging 0.99
R6020:Pygl UTSW 12 70,263,428 (GRCm39) missense probably damaging 1.00
R6024:Pygl UTSW 12 70,243,841 (GRCm39) missense probably benign 0.09
R7050:Pygl UTSW 12 70,266,396 (GRCm39) missense probably damaging 1.00
R7159:Pygl UTSW 12 70,244,180 (GRCm39) missense probably benign 0.41
R7194:Pygl UTSW 12 70,241,094 (GRCm39) missense probably benign
R7283:Pygl UTSW 12 70,263,342 (GRCm39) missense possibly damaging 0.92
R7360:Pygl UTSW 12 70,274,306 (GRCm39) missense probably benign 0.11
R7446:Pygl UTSW 12 70,243,784 (GRCm39) missense probably benign
R7637:Pygl UTSW 12 70,244,569 (GRCm39) splice site probably null
R7886:Pygl UTSW 12 70,253,130 (GRCm39) splice site probably null
R8054:Pygl UTSW 12 70,274,113 (GRCm39) critical splice donor site probably null
R8693:Pygl UTSW 12 70,244,180 (GRCm39) missense probably benign 0.41
R8753:Pygl UTSW 12 70,242,400 (GRCm39) missense probably damaging 1.00
R8803:Pygl UTSW 12 70,242,390 (GRCm39) missense probably damaging 1.00
R8842:Pygl UTSW 12 70,274,368 (GRCm39) intron probably benign
R9192:Pygl UTSW 12 70,243,822 (GRCm39) missense probably damaging 0.99
R9221:Pygl UTSW 12 70,242,401 (GRCm39) missense probably damaging 1.00
R9437:Pygl UTSW 12 70,246,925 (GRCm39) missense probably damaging 1.00
R9750:Pygl UTSW 12 70,245,303 (GRCm39) missense possibly damaging 0.68
Z1176:Pygl UTSW 12 70,269,648 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGGAAATATGTTGGCATCAGGG -3'
(R):5'- AGATTGCCATCAGATTCACTCTCTC -3'

Sequencing Primer
(F):5'- GCAAGCTATACCTTCAACTGTGGG -3'
(R):5'- TCCCTGTGCTCAGAAAGTTAGAC -3'
Posted On 2015-04-06