Mutagenetix > Incidental Mutations

Incidental Mutation 'R6024:Shank2'

479088

Institutional Source

Beutler Lab

Gene Symbol

Shank2

Ensembl Gene

ENSMUSG00000037541

Gene Name

SH3 and multiple ankyrin repeat domains 2

Synonyms

ProSAP1

MMRRC Submission

044196-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6024 (G1)

Quality Score

157.009

Status

Validated

Chromosome

Chromosomal Location

144001928-144424494 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 144180031 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 105 (T105I)

Ref Sequence

ENSEMBL: ENSMUSP00000101520 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105900] [ENSMUST00000105902] [ENSMUST00000213146]

Predicted Effect

probably benign
Transcript: ENSMUST00000105900
AA Change: T105I

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000101520
Gene: ENSMUSG00000037541
AA Change: T105I

Domain	Start	End	E-Value	Type
SH3	150	205	1.04e-14	SMART
PDZ	256	341	1.75e-14	SMART
low complexity region	345	364	N/A	INTRINSIC
low complexity region	509	524	N/A	INTRINSIC
low complexity region	662	674	N/A	INTRINSIC
low complexity region	749	760	N/A	INTRINSIC
low complexity region	780	792	N/A	INTRINSIC
low complexity region	829	847	N/A	INTRINSIC
low complexity region	1024	1038	N/A	INTRINSIC
low complexity region	1093	1104	N/A	INTRINSIC
low complexity region	1125	1147	N/A	INTRINSIC
low complexity region	1161	1177	N/A	INTRINSIC
low complexity region	1199	1207	N/A	INTRINSIC
low complexity region	1287	1301	N/A	INTRINSIC
low complexity region	1344	1359	N/A	INTRINSIC
low complexity region	1383	1397	N/A	INTRINSIC
SAM	1406	1472	2.52e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105902
AA Change: T484I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000101522
Gene: ENSMUSG00000037541
AA Change: T484I

Domain	Start	End	E-Value	Type
low complexity region	15	28	N/A	INTRINSIC
Pfam:FERM_f0	57	140	1.4e-21	PFAM
ANK	196	226	1.4e1	SMART
ANK	230	259	2.77e-3	SMART
ANK	263	293	1.42e0	SMART
ANK	297	326	1.25e-1	SMART
ANK	330	359	7.83e-3	SMART
ANK	363	391	1.29e2	SMART
SH3	529	584	1.04e-14	SMART
PDZ	635	720	1.75e-14	SMART
low complexity region	724	743	N/A	INTRINSIC
low complexity region	878	893	N/A	INTRINSIC
low complexity region	1031	1043	N/A	INTRINSIC
low complexity region	1118	1129	N/A	INTRINSIC
low complexity region	1149	1161	N/A	INTRINSIC
low complexity region	1198	1216	N/A	INTRINSIC
low complexity region	1393	1407	N/A	INTRINSIC
low complexity region	1462	1473	N/A	INTRINSIC
low complexity region	1494	1516	N/A	INTRINSIC
low complexity region	1530	1546	N/A	INTRINSIC
low complexity region	1568	1576	N/A	INTRINSIC
low complexity region	1656	1670	N/A	INTRINSIC
low complexity region	1713	1728	N/A	INTRINSIC
low complexity region	1752	1766	N/A	INTRINSIC
SAM	1775	1841	2.52e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000213146
AA Change: T541I

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.0%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the Shank family of synaptic proteins that may function as molecular scaffolds in the postsynaptic density of excitatory synapses. Shank proteins contain multiple domains for protein-protein interaction, including ankyrin repeats, and an SH3 domain. This particular family member contains a PDZ domain, a consensus sequence for cortactin SH3 domain-binding peptides and a sterile alpha motif. The alternative splicing demonstrated in Shank genes has been suggested as a mechanism for regulating the molecular structure of Shank and the spectrum of Shank-interacting proteins in the postsynaptic densities of the adult and developing brain. Alterations in the encoded protein may be associated with susceptibility to autism spectrum disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for null mutations display hyperactivity and abnormal social behavior. Mice homozygous for one null allele also display partial postnal lethality and limb grasping. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	G	13: 81,476,505	F3782L	probably benign	Het
Akr1d1	T	C	6: 37,558,482	I267T	probably benign	Het
Arhgef5	T	C	6: 43,275,134	S940P	probably benign	Het
Art2b	A	G	7: 101,580,380	I104T	probably benign	Het
Avpr1a	A	G	10: 122,449,148	Y115C	probably damaging	Het
Ccdc84	T	C	9: 44,417,952	T13A	possibly damaging	Het
Cdc42bpg	T	A	19: 6,317,496	L995Q	probably damaging	Het
Clip1	T	C	5: 123,615,089	K210E	possibly damaging	Het
Cog4	C	T	8: 110,881,480	T735I	probably damaging	Het
Creb3l4	G	A	3: 90,238,699	S206L	probably damaging	Het
Csf3r	C	A	4: 126,037,517		probably null	Het
Dnah11	G	T	12: 118,030,272	S2346R	probably benign	Het
Dnaic2	A	T	11: 114,752,908	I467F	possibly damaging	Het
Doxl2	A	T	6: 48,976,096	K318N	possibly damaging	Het
Dpy19l4	A	T	4: 11,276,876	M523K	probably damaging	Het
Ebf3	T	C	7: 137,200,535	D407G	probably damaging	Het
Fbn2	A	G	18: 58,076,836	I991T	probably benign	Het
Gcc1	T	C	6: 28,419,300	T345A	probably benign	Het
Gm1527	C	T	3: 28,920,603	H522Y	probably benign	Het
Gm340	C	A	19: 41,583,957	P384T	possibly damaging	Het
Gm4846	T	A	1: 166,490,127	Y240F	probably benign	Het
Hmgcl	T	C	4: 135,955,615	V126A	probably benign	Het
Ifit1bl2	G	T	19: 34,620,038	S59R	probably benign	Het
Itga6	A	G	2: 71,787,233	N32S	probably benign	Het
Macc1	T	C	12: 119,450,425	S779P	probably benign	Het
Mctp1	G	T	13: 76,385,161	L209F	probably damaging	Het
Mink1	A	G	11: 70,599,089	N97S	possibly damaging	Het
Mst1r	T	A	9: 107,908,151	V336E	probably benign	Het
Muc16	A	T	9: 18,646,671	S2775R	unknown	Het
Muc6	T	A	7: 141,641,574	T1316S	possibly damaging	Het
Myh11	T	A	16: 14,277,703	N65I	probably damaging	Het
Myo9a	A	G	9: 59,855,388	N801D	possibly damaging	Het
Nkain2	A	T	10: 31,951,285	M103K	probably damaging	Het
Nkx2-2	T	A	2: 147,184,041	Y259F	probably benign	Het
Nrxn1	T	C	17: 90,590,098	M877V	possibly damaging	Het
Nxf1	C	T	19: 8,767,744	L453F	probably damaging	Het
Pcnt	T	C	10: 76,420,037	S790G	possibly damaging	Het
Phf3	T	C	1: 30,863,226	D2G	probably damaging	Het
Phrf1	T	C	7: 141,258,985		probably benign	Het
Ptpn3	C	A	4: 57,248,653		probably null	Het
Pygl	T	C	12: 70,197,067	T625A	probably benign	Het
R3hdm2	T	A	10: 127,459,480	F239I	probably damaging	Het
Sesn1	A	T	10: 41,896,200	I242F	probably damaging	Het
Skint3	T	C	4: 112,290,346	F350S	possibly damaging	Het
Slco5a1	T	C	1: 12,944,070	Y320C	probably damaging	Het
Syt11	A	G	3: 88,762,109	S159P	probably benign	Het
Tanc2	G	A	11: 105,867,717	R768Q	probably damaging	Het
Tanc2	T	C	11: 105,923,672	S1981P	probably damaging	Het
Tmem200c	A	C	17: 68,841,727	D435A	possibly damaging	Het
Trappc8	A	G	18: 20,833,009	V1125A	probably damaging	Het
Ttn	A	G	2: 76,814,143	V4762A	possibly damaging	Het
Unc5d	A	G	8: 28,875,511	S149P	possibly damaging	Het
Usf3	A	T	16: 44,219,840	N1561I	probably damaging	Het
Wdr4	A	T	17: 31,501,298		probably benign	Het
Wdr49	T	G	3: 75,301,826	E612D	probably benign	Het

Other mutations in Shank2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Shank2	APN	7	144411847	missense	probably damaging	1.00
IGL00516:Shank2	APN	7	144410775	missense	possibly damaging	0.96
IGL00919:Shank2	APN	7	144411271	missense	probably damaging	0.97
IGL01450:Shank2	APN	7	144285068	nonsense	probably null
IGL01996:Shank2	APN	7	144411493	missense	probably damaging	1.00
IGL02217:Shank2	APN	7	144285047	missense	possibly damaging	0.59
IGL02314:Shank2	APN	7	144411271	missense	probably benign	0.01
IGL02320:Shank2	APN	7	144420944	missense	probably damaging	1.00
IGL02948:Shank2	APN	7	144409636	missense	probably benign	0.03
IGL02997:Shank2	APN	7	144081873	missense	probably benign	0.16
R0077:Shank2	UTSW	7	144192467	missense	possibly damaging	0.85
R0109:Shank2	UTSW	7	144410577	missense	possibly damaging	0.81
R0126:Shank2	UTSW	7	144031355	missense	probably damaging	0.99
R0153:Shank2	UTSW	7	144070135	missense	probably benign	0.04
R0644:Shank2	UTSW	7	144411849	missense	probably benign
R1072:Shank2	UTSW	7	144411568	missense	probably damaging	1.00
R1245:Shank2	UTSW	7	144411720	missense	probably benign	0.00
R1424:Shank2	UTSW	7	144052372	missense	probably damaging	0.99
R1712:Shank2	UTSW	7	144411153	missense	probably damaging	1.00
R1739:Shank2	UTSW	7	144179853	missense	probably damaging	1.00
R1791:Shank2	UTSW	7	144410599	missense	probably damaging	1.00
R1889:Shank2	UTSW	7	144186858	nonsense	probably null
R2074:Shank2	UTSW	7	144409540	missense	probably damaging	1.00
R2135:Shank2	UTSW	7	144411234	missense	probably damaging	0.99
R2355:Shank2	UTSW	7	144057718	missense	possibly damaging	0.94
R2511:Shank2	UTSW	7	144411577	missense	probably damaging	1.00
R2517:Shank2	UTSW	7	144052305	missense	possibly damaging	0.89
R2570:Shank2	UTSW	7	144068770	missense	probably damaging	1.00
R2846:Shank2	UTSW	7	144070055	missense	probably damaging	1.00
R3159:Shank2	UTSW	7	144081874	missense	probably damaging	0.98
R3881:Shank2	UTSW	7	144405384	missense	probably benign
R3907:Shank2	UTSW	7	144409576	missense	probably damaging	1.00
R3938:Shank2	UTSW	7	144128375	missense	probably benign	0.20
R4151:Shank2	UTSW	7	144054828	missense	probably damaging	1.00
R4369:Shank2	UTSW	7	144179781	missense	probably damaging	0.99
R4372:Shank2	UTSW	7	144410862	missense	probably benign	0.09
R4519:Shank2	UTSW	7	144410205	missense	probably damaging	1.00
R4627:Shank2	UTSW	7	144411424	missense	probably damaging	1.00
R4645:Shank2	UTSW	7	144410422	missense	possibly damaging	0.65
R4647:Shank2	UTSW	7	144411829	missense	probably damaging	1.00
R4689:Shank2	UTSW	7	144420605	missense	probably benign	0.07
R4751:Shank2	UTSW	7	144409468	missense	probably damaging	1.00
R4816:Shank2	UTSW	7	144052306	missense	probably damaging	1.00
R4843:Shank2	UTSW	7	144031409	missense	probably benign	0.17
R4929:Shank2	UTSW	7	144411271	missense	probably benign	0.01
R5009:Shank2	UTSW	7	144070179	missense	probably benign	0.00
R5027:Shank2	UTSW	7	144259105	nonsense	probably null
R5165:Shank2	UTSW	7	144409636	missense	possibly damaging	0.62
R5278:Shank2	UTSW	7	144068875	critical splice donor site	probably null
R5332:Shank2	UTSW	7	144411292	missense	possibly damaging	0.82
R5497:Shank2	UTSW	7	144409534	missense	probably damaging	1.00
R5525:Shank2	UTSW	7	144070109	missense	probably damaging	1.00
R5575:Shank2	UTSW	7	144410134	missense	probably damaging	1.00
R5948:Shank2	UTSW	7	144407223	missense	probably damaging	0.98
R6306:Shank2	UTSW	7	144409680	missense	probably benign	0.00
R6317:Shank2	UTSW	7	144285084	missense	possibly damaging	0.89
R6358:Shank2	UTSW	7	144031297	missense	probably benign	0.25
R6364:Shank2	UTSW	7	144410409	missense	probably benign	0.14
R6413:Shank2	UTSW	7	144410218	missense	probably damaging	1.00
R6680:Shank2	UTSW	7	144420866	missense	probably damaging	1.00
R6834:Shank2	UTSW	7	144409894	missense	probably damaging	1.00
R6870:Shank2	UTSW	7	144052460	missense	probably damaging	0.99
R6933:Shank2	UTSW	7	144091778	missense	probably benign	0.19
R6983:Shank2	UTSW	7	144081848	missense	possibly damaging	0.94
R7082:Shank2	UTSW	7	144410359	missense	probably damaging	0.99
R7100:Shank2	UTSW	7	144411164	missense	possibly damaging	0.73
R7111:Shank2	UTSW	7	144411552	missense	probably benign	0.00
R7213:Shank2	UTSW	7	144031409	missense	probably benign	0.17
R7225:Shank2	UTSW	7	144285025	missense	probably benign	0.42
R7325:Shank2	UTSW	7	144411685	missense	probably benign	0.04
R7605:Shank2	UTSW	7	144091779	missense	possibly damaging	0.64
R7909:Shank2	UTSW	7	144411394	missense	probably damaging	1.00
R7990:Shank2	UTSW	7	144411394	missense	probably damaging	1.00
RF009:Shank2	UTSW	7	144411571	missense	possibly damaging	0.81
Z1176:Shank2	UTSW	7	144128377	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GTTCTTCTGCGTTCTAATAGTGAC -3'
(R):5'- ACATAAGGTCCCTGCACAGC -3'

Sequencing Primer
(F):5'- GTGACAACAACCTCAATGCTGGTG -3'
(R):5'- TGCCCCTGCATTAAGAGTACTGG -3'

Posted On

2017-06-26