Incidental Mutation 'R6024:Shank2'
ID479088
Institutional Source Beutler Lab
Gene Symbol Shank2
Ensembl Gene ENSMUSG00000037541
Gene NameSH3 and multiple ankyrin repeat domains 2
SynonymsProSAP1
MMRRC Submission 044196-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6024 (G1)
Quality Score157.009
Status Validated
Chromosome7
Chromosomal Location144001928-144424494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 144180031 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 105 (T105I)
Ref Sequence ENSEMBL: ENSMUSP00000101520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105900] [ENSMUST00000105902] [ENSMUST00000213146]
Predicted Effect probably benign
Transcript: ENSMUST00000105900
AA Change: T105I

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101520
Gene: ENSMUSG00000037541
AA Change: T105I

DomainStartEndE-ValueType
SH3 150 205 1.04e-14 SMART
PDZ 256 341 1.75e-14 SMART
low complexity region 345 364 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
low complexity region 662 674 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 780 792 N/A INTRINSIC
low complexity region 829 847 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
low complexity region 1125 1147 N/A INTRINSIC
low complexity region 1161 1177 N/A INTRINSIC
low complexity region 1199 1207 N/A INTRINSIC
low complexity region 1287 1301 N/A INTRINSIC
low complexity region 1344 1359 N/A INTRINSIC
low complexity region 1383 1397 N/A INTRINSIC
SAM 1406 1472 2.52e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105902
AA Change: T484I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101522
Gene: ENSMUSG00000037541
AA Change: T484I

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:FERM_f0 57 140 1.4e-21 PFAM
ANK 196 226 1.4e1 SMART
ANK 230 259 2.77e-3 SMART
ANK 263 293 1.42e0 SMART
ANK 297 326 1.25e-1 SMART
ANK 330 359 7.83e-3 SMART
ANK 363 391 1.29e2 SMART
SH3 529 584 1.04e-14 SMART
PDZ 635 720 1.75e-14 SMART
low complexity region 724 743 N/A INTRINSIC
low complexity region 878 893 N/A INTRINSIC
low complexity region 1031 1043 N/A INTRINSIC
low complexity region 1118 1129 N/A INTRINSIC
low complexity region 1149 1161 N/A INTRINSIC
low complexity region 1198 1216 N/A INTRINSIC
low complexity region 1393 1407 N/A INTRINSIC
low complexity region 1462 1473 N/A INTRINSIC
low complexity region 1494 1516 N/A INTRINSIC
low complexity region 1530 1546 N/A INTRINSIC
low complexity region 1568 1576 N/A INTRINSIC
low complexity region 1656 1670 N/A INTRINSIC
low complexity region 1713 1728 N/A INTRINSIC
low complexity region 1752 1766 N/A INTRINSIC
SAM 1775 1841 2.52e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213146
AA Change: T541I

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the Shank family of synaptic proteins that may function as molecular scaffolds in the postsynaptic density of excitatory synapses. Shank proteins contain multiple domains for protein-protein interaction, including ankyrin repeats, and an SH3 domain. This particular family member contains a PDZ domain, a consensus sequence for cortactin SH3 domain-binding peptides and a sterile alpha motif. The alternative splicing demonstrated in Shank genes has been suggested as a mechanism for regulating the molecular structure of Shank and the spectrum of Shank-interacting proteins in the postsynaptic densities of the adult and developing brain. Alterations in the encoded protein may be associated with susceptibility to autism spectrum disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for null mutations display hyperactivity and abnormal social behavior. Mice homozygous for one null allele also display partial postnal lethality and limb grasping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A G 13: 81,476,505 F3782L probably benign Het
Akr1d1 T C 6: 37,558,482 I267T probably benign Het
Arhgef5 T C 6: 43,275,134 S940P probably benign Het
Art2b A G 7: 101,580,380 I104T probably benign Het
Avpr1a A G 10: 122,449,148 Y115C probably damaging Het
Ccdc84 T C 9: 44,417,952 T13A possibly damaging Het
Cdc42bpg T A 19: 6,317,496 L995Q probably damaging Het
Clip1 T C 5: 123,615,089 K210E possibly damaging Het
Cog4 C T 8: 110,881,480 T735I probably damaging Het
Creb3l4 G A 3: 90,238,699 S206L probably damaging Het
Csf3r C A 4: 126,037,517 probably null Het
Dnah11 G T 12: 118,030,272 S2346R probably benign Het
Dnaic2 A T 11: 114,752,908 I467F possibly damaging Het
Doxl2 A T 6: 48,976,096 K318N possibly damaging Het
Dpy19l4 A T 4: 11,276,876 M523K probably damaging Het
Ebf3 T C 7: 137,200,535 D407G probably damaging Het
Fbn2 A G 18: 58,076,836 I991T probably benign Het
Gcc1 T C 6: 28,419,300 T345A probably benign Het
Gm1527 C T 3: 28,920,603 H522Y probably benign Het
Gm340 C A 19: 41,583,957 P384T possibly damaging Het
Gm4846 T A 1: 166,490,127 Y240F probably benign Het
Hmgcl T C 4: 135,955,615 V126A probably benign Het
Ifit1bl2 G T 19: 34,620,038 S59R probably benign Het
Itga6 A G 2: 71,787,233 N32S probably benign Het
Macc1 T C 12: 119,450,425 S779P probably benign Het
Mctp1 G T 13: 76,385,161 L209F probably damaging Het
Mink1 A G 11: 70,599,089 N97S possibly damaging Het
Mst1r T A 9: 107,908,151 V336E probably benign Het
Muc16 A T 9: 18,646,671 S2775R unknown Het
Muc6 T A 7: 141,641,574 T1316S possibly damaging Het
Myh11 T A 16: 14,277,703 N65I probably damaging Het
Myo9a A G 9: 59,855,388 N801D possibly damaging Het
Nkain2 A T 10: 31,951,285 M103K probably damaging Het
Nkx2-2 T A 2: 147,184,041 Y259F probably benign Het
Nrxn1 T C 17: 90,590,098 M877V possibly damaging Het
Nxf1 C T 19: 8,767,744 L453F probably damaging Het
Pcnt T C 10: 76,420,037 S790G possibly damaging Het
Phf3 T C 1: 30,863,226 D2G probably damaging Het
Phrf1 T C 7: 141,258,985 probably benign Het
Ptpn3 C A 4: 57,248,653 probably null Het
Pygl T C 12: 70,197,067 T625A probably benign Het
R3hdm2 T A 10: 127,459,480 F239I probably damaging Het
Sesn1 A T 10: 41,896,200 I242F probably damaging Het
Skint3 T C 4: 112,290,346 F350S possibly damaging Het
Slco5a1 T C 1: 12,944,070 Y320C probably damaging Het
Syt11 A G 3: 88,762,109 S159P probably benign Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tanc2 T C 11: 105,923,672 S1981P probably damaging Het
Tmem200c A C 17: 68,841,727 D435A possibly damaging Het
Trappc8 A G 18: 20,833,009 V1125A probably damaging Het
Ttn A G 2: 76,814,143 V4762A possibly damaging Het
Unc5d A G 8: 28,875,511 S149P possibly damaging Het
Usf3 A T 16: 44,219,840 N1561I probably damaging Het
Wdr4 A T 17: 31,501,298 probably benign Het
Wdr49 T G 3: 75,301,826 E612D probably benign Het
Other mutations in Shank2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Shank2 APN 7 144411847 missense probably damaging 1.00
IGL00516:Shank2 APN 7 144410775 missense possibly damaging 0.96
IGL00919:Shank2 APN 7 144411271 missense probably damaging 0.97
IGL01450:Shank2 APN 7 144285068 nonsense probably null
IGL01996:Shank2 APN 7 144411493 missense probably damaging 1.00
IGL02217:Shank2 APN 7 144285047 missense possibly damaging 0.59
IGL02314:Shank2 APN 7 144411271 missense probably benign 0.01
IGL02320:Shank2 APN 7 144420944 missense probably damaging 1.00
IGL02948:Shank2 APN 7 144409636 missense probably benign 0.03
IGL02997:Shank2 APN 7 144081873 missense probably benign 0.16
R0077:Shank2 UTSW 7 144192467 missense possibly damaging 0.85
R0109:Shank2 UTSW 7 144410577 missense possibly damaging 0.81
R0126:Shank2 UTSW 7 144031355 missense probably damaging 0.99
R0153:Shank2 UTSW 7 144070135 missense probably benign 0.04
R0644:Shank2 UTSW 7 144411849 missense probably benign
R1072:Shank2 UTSW 7 144411568 missense probably damaging 1.00
R1245:Shank2 UTSW 7 144411720 missense probably benign 0.00
R1424:Shank2 UTSW 7 144052372 missense probably damaging 0.99
R1712:Shank2 UTSW 7 144411153 missense probably damaging 1.00
R1739:Shank2 UTSW 7 144179853 missense probably damaging 1.00
R1791:Shank2 UTSW 7 144410599 missense probably damaging 1.00
R1889:Shank2 UTSW 7 144186858 nonsense probably null
R2074:Shank2 UTSW 7 144409540 missense probably damaging 1.00
R2135:Shank2 UTSW 7 144411234 missense probably damaging 0.99
R2355:Shank2 UTSW 7 144057718 missense possibly damaging 0.94
R2511:Shank2 UTSW 7 144411577 missense probably damaging 1.00
R2517:Shank2 UTSW 7 144052305 missense possibly damaging 0.89
R2570:Shank2 UTSW 7 144068770 missense probably damaging 1.00
R2846:Shank2 UTSW 7 144070055 missense probably damaging 1.00
R3159:Shank2 UTSW 7 144081874 missense probably damaging 0.98
R3881:Shank2 UTSW 7 144405384 missense probably benign
R3907:Shank2 UTSW 7 144409576 missense probably damaging 1.00
R3938:Shank2 UTSW 7 144128375 missense probably benign 0.20
R4151:Shank2 UTSW 7 144054828 missense probably damaging 1.00
R4369:Shank2 UTSW 7 144179781 missense probably damaging 0.99
R4372:Shank2 UTSW 7 144410862 missense probably benign 0.09
R4519:Shank2 UTSW 7 144410205 missense probably damaging 1.00
R4627:Shank2 UTSW 7 144411424 missense probably damaging 1.00
R4645:Shank2 UTSW 7 144410422 missense possibly damaging 0.65
R4647:Shank2 UTSW 7 144411829 missense probably damaging 1.00
R4689:Shank2 UTSW 7 144420605 missense probably benign 0.07
R4751:Shank2 UTSW 7 144409468 missense probably damaging 1.00
R4816:Shank2 UTSW 7 144052306 missense probably damaging 1.00
R4843:Shank2 UTSW 7 144031409 missense probably benign 0.17
R4929:Shank2 UTSW 7 144411271 missense probably benign 0.01
R5009:Shank2 UTSW 7 144070179 missense probably benign 0.00
R5027:Shank2 UTSW 7 144259105 nonsense probably null
R5165:Shank2 UTSW 7 144409636 missense possibly damaging 0.62
R5278:Shank2 UTSW 7 144068875 critical splice donor site probably null
R5332:Shank2 UTSW 7 144411292 missense possibly damaging 0.82
R5497:Shank2 UTSW 7 144409534 missense probably damaging 1.00
R5525:Shank2 UTSW 7 144070109 missense probably damaging 1.00
R5575:Shank2 UTSW 7 144410134 missense probably damaging 1.00
R5948:Shank2 UTSW 7 144407223 missense probably damaging 0.98
R6306:Shank2 UTSW 7 144409680 missense probably benign 0.00
R6317:Shank2 UTSW 7 144285084 missense possibly damaging 0.89
R6358:Shank2 UTSW 7 144031297 missense probably benign 0.25
R6364:Shank2 UTSW 7 144410409 missense probably benign 0.14
R6413:Shank2 UTSW 7 144410218 missense probably damaging 1.00
R6680:Shank2 UTSW 7 144420866 missense probably damaging 1.00
R6834:Shank2 UTSW 7 144409894 missense probably damaging 1.00
R6870:Shank2 UTSW 7 144052460 missense probably damaging 0.99
R6933:Shank2 UTSW 7 144091778 missense probably benign 0.19
R6983:Shank2 UTSW 7 144081848 missense possibly damaging 0.94
R7082:Shank2 UTSW 7 144410359 missense probably damaging 0.99
R7100:Shank2 UTSW 7 144411164 missense possibly damaging 0.73
R7111:Shank2 UTSW 7 144411552 missense probably benign 0.00
R7213:Shank2 UTSW 7 144031409 missense probably benign 0.17
R7225:Shank2 UTSW 7 144285025 missense probably benign 0.42
R7325:Shank2 UTSW 7 144411685 missense probably benign 0.04
R7605:Shank2 UTSW 7 144091779 missense possibly damaging 0.64
R7909:Shank2 UTSW 7 144411394 missense probably damaging 1.00
R7990:Shank2 UTSW 7 144411394 missense probably damaging 1.00
RF009:Shank2 UTSW 7 144411571 missense possibly damaging 0.81
Z1176:Shank2 UTSW 7 144128377 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTCTTCTGCGTTCTAATAGTGAC -3'
(R):5'- ACATAAGGTCCCTGCACAGC -3'

Sequencing Primer
(F):5'- GTGACAACAACCTCAATGCTGGTG -3'
(R):5'- TGCCCCTGCATTAAGAGTACTGG -3'
Posted On2017-06-26