Incidental Mutation 'R4050:Fam208b'
ID 314124
Institutional Source Beutler Lab
Gene Symbol Fam208b
Ensembl Gene ENSMUSG00000033799
Gene Name family with sequence similarity 208, member B
Synonyms BC016423
MMRRC Submission 040968-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R4050 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 3566035-3611108 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 3573507 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 2148 (S2148P)
Ref Sequence ENSEMBL: ENSMUSP00000093774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096069]
AlphaFold Q5DTT3
Predicted Effect probably benign
Transcript: ENSMUST00000096069
AA Change: S2148P

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000093774
Gene: ENSMUSG00000033799
AA Change: S2148P

DomainStartEndE-ValueType
Pfam:DUF3699 91 167 1.4e-24 PFAM
low complexity region 272 282 N/A INTRINSIC
low complexity region 447 459 N/A INTRINSIC
Pfam:DUF3715 533 695 2.3e-25 PFAM
low complexity region 1156 1168 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 2012 2021 N/A INTRINSIC
low complexity region 2250 2263 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222615
Predicted Effect unknown
Transcript: ENSMUST00000222909
AA Change: S1466P
Meta Mutation Damage Score 0.1760 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 147,944,992 (GRCm38) D473G probably damaging Het
9530053A07Rik T C 7: 28,152,985 (GRCm38) V1311A possibly damaging Het
Abca1 T A 4: 53,044,144 (GRCm38) Q1826L probably damaging Het
Apob G A 12: 8,015,390 (GRCm38) V4087I probably benign Het
Atp10b G A 11: 43,259,536 (GRCm38) A1354T probably benign Het
Baz1a A G 12: 54,929,619 (GRCm38) V424A probably benign Het
Cdc20b G A 13: 113,064,285 (GRCm38) D180N probably benign Het
Cep57l1 G T 10: 41,729,360 (GRCm38) R130S probably damaging Het
Ddb1 A G 19: 10,627,807 (GRCm38) D1053G probably benign Het
Ddx39 T A 8: 83,722,234 (GRCm38) M246K probably benign Het
Dip2a G A 10: 76,278,607 (GRCm38) T1013M probably damaging Het
Edar G T 10: 58,609,947 (GRCm38) T265N possibly damaging Het
Fam207a T C 10: 77,514,330 (GRCm38) R75G possibly damaging Het
Gbp8 T A 5: 105,031,238 (GRCm38) I132F probably damaging Het
Gga1 A G 15: 78,891,491 (GRCm38) D382G probably benign Het
Ggps1 T C 13: 14,053,699 (GRCm38) K300E probably benign Het
Gm10518 C A 1: 179,803,813 (GRCm38) probably benign Het
Gm13078 T C 4: 143,727,122 (GRCm38) S267P probably benign Het
Gm8074 G A 9: 78,322,336 (GRCm38) noncoding transcript Het
H2-Eb1 T A 17: 34,314,368 (GRCm38) L188Q probably damaging Het
Heatr6 A G 11: 83,755,773 (GRCm38) S95G probably damaging Het
Hnf1a T A 5: 114,970,574 (GRCm38) N91Y probably damaging Het
Ints10 C T 8: 68,827,351 (GRCm38) S710F probably damaging Het
Kazn C T 4: 142,106,904 (GRCm38) E614K unknown Het
Kif26a T A 12: 112,179,916 (GRCm38) M1812K probably benign Het
Lmo7 A T 14: 101,902,277 (GRCm38) K488* probably null Het
Mad1l1 A G 5: 140,132,816 (GRCm38) S457P probably damaging Het
Met A G 6: 17,533,984 (GRCm38) T645A probably benign Het
Mpp4 T C 1: 59,146,744 (GRCm38) probably null Het
Mycl A T 4: 122,996,839 (GRCm38) probably null Het
Ncbp1 G A 4: 46,147,483 (GRCm38) R110H probably damaging Het
Nfasc G T 1: 132,610,305 (GRCm38) probably benign Het
Nup35 A G 2: 80,655,976 (GRCm38) I212V probably benign Het
Olfr1181 A G 2: 88,423,623 (GRCm38) M134T probably damaging Het
Olfr1373 T G 11: 52,145,134 (GRCm38) Y132S probably damaging Het
Ovgp1 A G 3: 105,986,596 (GRCm38) probably benign Het
Ovgp1 T C 3: 105,986,567 (GRCm38) probably benign Het
Pcgf5 G A 19: 36,442,911 (GRCm38) S181N probably damaging Het
Plk2 C T 13: 110,399,866 (GRCm38) T617I probably damaging Het
Polq A T 16: 37,092,820 (GRCm38) probably null Het
Ppp1r1a A G 15: 103,532,454 (GRCm38) L92P probably damaging Het
Prg4 G C 1: 150,454,759 (GRCm38) probably benign Het
Prune1 T C 3: 95,262,231 (GRCm38) K220R possibly damaging Het
Rab3gap2 G A 1: 185,272,643 (GRCm38) probably null Het
Rufy4 T C 1: 74,147,663 (GRCm38) C537R probably damaging Het
Sall3 G A 18: 80,971,482 (GRCm38) A1005V probably benign Het
Samd15 T G 12: 87,200,632 (GRCm38) N30K probably benign Het
Scn8a A T 15: 101,013,413 (GRCm38) K905* probably null Het
Scrib G A 15: 76,051,473 (GRCm38) R1245W possibly damaging Het
Skint4 C T 4: 112,124,614 (GRCm38) S260L probably benign Het
Slc29a2 A T 19: 5,029,453 (GRCm38) M339L possibly damaging Het
Spire1 G T 18: 67,529,031 (GRCm38) probably null Het
Synpo2 T C 3: 123,114,278 (GRCm38) D463G possibly damaging Het
Taf4 C A 2: 179,932,012 (GRCm38) G688C probably damaging Het
Tpte T A 8: 22,365,984 (GRCm38) V600E probably damaging Het
Ttn A G 2: 76,821,166 (GRCm38) V10953A probably benign Het
Vav2 A G 2: 27,291,403 (GRCm38) S311P probably damaging Het
Vav2 T C 2: 27,288,679 (GRCm38) Y333C probably benign Het
Zbtb26 A C 2: 37,436,988 (GRCm38) M1R probably null Het
Zfp26 G A 9: 20,442,229 (GRCm38) P88L probably benign Het
Zfp324 T C 7: 12,970,867 (GRCm38) F328L probably damaging Het
Other mutations in Fam208b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Fam208b APN 13 3,574,832 (GRCm38) missense probably benign
IGL00670:Fam208b APN 13 3,585,241 (GRCm38) missense probably benign 0.14
IGL00957:Fam208b APN 13 3,577,101 (GRCm38) missense possibly damaging 0.86
IGL01311:Fam208b APN 13 3,575,885 (GRCm38) missense possibly damaging 0.85
IGL01318:Fam208b APN 13 3,575,067 (GRCm38) missense possibly damaging 0.66
IGL01767:Fam208b APN 13 3,576,633 (GRCm38) missense probably benign 0.00
IGL02073:Fam208b APN 13 3,574,721 (GRCm38) missense probably benign 0.01
IGL02152:Fam208b APN 13 3,585,371 (GRCm38) missense probably benign
IGL02431:Fam208b APN 13 3,574,736 (GRCm38) missense possibly damaging 0.85
IGL02478:Fam208b APN 13 3,574,661 (GRCm38) missense probably benign 0.12
IGL02732:Fam208b APN 13 3,573,626 (GRCm38) missense probably benign 0.09
IGL02745:Fam208b APN 13 3,585,140 (GRCm38) missense probably benign 0.23
IGL02800:Fam208b APN 13 3,585,154 (GRCm38) missense probably benign
IGL02989:Fam208b APN 13 3,584,820 (GRCm38) missense probably benign 0.01
IGL03124:Fam208b APN 13 3,574,704 (GRCm38) missense probably benign 0.41
IGL03154:Fam208b APN 13 3,575,255 (GRCm38) missense possibly damaging 0.56
IGL03216:Fam208b APN 13 3,574,553 (GRCm38) missense probably damaging 0.98
BB001:Fam208b UTSW 13 3,594,331 (GRCm38) missense possibly damaging 0.92
BB011:Fam208b UTSW 13 3,594,331 (GRCm38) missense possibly damaging 0.92
H8562:Fam208b UTSW 13 3,577,000 (GRCm38) missense probably damaging 0.98
PIT4585001:Fam208b UTSW 13 3,574,979 (GRCm38) missense possibly damaging 0.55
R0016:Fam208b UTSW 13 3,585,170 (GRCm38) splice site probably null
R0016:Fam208b UTSW 13 3,585,170 (GRCm38) splice site probably null
R0157:Fam208b UTSW 13 3,575,550 (GRCm38) missense probably benign 0.06
R0375:Fam208b UTSW 13 3,596,842 (GRCm38) missense possibly damaging 0.85
R0403:Fam208b UTSW 13 3,582,052 (GRCm38) nonsense probably null
R0472:Fam208b UTSW 13 3,588,364 (GRCm38) missense possibly damaging 0.93
R0517:Fam208b UTSW 13 3,566,964 (GRCm38) missense possibly damaging 0.94
R0586:Fam208b UTSW 13 3,590,321 (GRCm38) missense probably damaging 0.99
R0600:Fam208b UTSW 13 3,576,054 (GRCm38) missense probably benign
R0659:Fam208b UTSW 13 3,574,448 (GRCm38) missense probably damaging 0.99
R1257:Fam208b UTSW 13 3,575,049 (GRCm38) missense probably benign 0.25
R1375:Fam208b UTSW 13 3,576,029 (GRCm38) missense probably benign 0.06
R1443:Fam208b UTSW 13 3,575,543 (GRCm38) missense probably benign 0.00
R1497:Fam208b UTSW 13 3,570,409 (GRCm38) missense probably damaging 0.96
R1544:Fam208b UTSW 13 3,590,413 (GRCm38) missense possibly damaging 0.68
R1554:Fam208b UTSW 13 3,576,374 (GRCm38) missense possibly damaging 0.85
R1629:Fam208b UTSW 13 3,574,121 (GRCm38) missense possibly damaging 0.84
R1633:Fam208b UTSW 13 3,581,771 (GRCm38) missense possibly damaging 0.53
R1661:Fam208b UTSW 13 3,573,860 (GRCm38) missense possibly damaging 0.63
R1673:Fam208b UTSW 13 3,584,498 (GRCm38) critical splice donor site probably null
R1675:Fam208b UTSW 13 3,569,507 (GRCm38) missense possibly damaging 0.65
R1781:Fam208b UTSW 13 3,584,759 (GRCm38) missense possibly damaging 0.95
R1792:Fam208b UTSW 13 3,590,559 (GRCm38) missense possibly damaging 0.91
R1826:Fam208b UTSW 13 3,581,759 (GRCm38) missense probably damaging 0.98
R1920:Fam208b UTSW 13 3,576,612 (GRCm38) missense possibly damaging 0.63
R1983:Fam208b UTSW 13 3,574,853 (GRCm38) missense possibly damaging 0.92
R2016:Fam208b UTSW 13 3,576,770 (GRCm38) missense probably benign 0.41
R2017:Fam208b UTSW 13 3,576,770 (GRCm38) missense probably benign 0.41
R2220:Fam208b UTSW 13 3,581,872 (GRCm38) missense probably benign 0.00
R2513:Fam208b UTSW 13 3,582,150 (GRCm38) missense possibly damaging 0.53
R2898:Fam208b UTSW 13 3,585,122 (GRCm38) missense possibly damaging 0.82
R2904:Fam208b UTSW 13 3,582,185 (GRCm38) missense possibly damaging 0.53
R3149:Fam208b UTSW 13 3,574,359 (GRCm38) missense probably damaging 0.98
R3623:Fam208b UTSW 13 3,595,556 (GRCm38) missense probably benign
R3624:Fam208b UTSW 13 3,595,556 (GRCm38) missense probably benign
R3725:Fam208b UTSW 13 3,590,538 (GRCm38) missense probably benign 0.33
R3835:Fam208b UTSW 13 3,575,292 (GRCm38) missense probably benign 0.01
R3890:Fam208b UTSW 13 3,596,785 (GRCm38) missense probably damaging 0.96
R4023:Fam208b UTSW 13 3,584,554 (GRCm38) missense probably damaging 0.99
R4024:Fam208b UTSW 13 3,584,554 (GRCm38) missense probably damaging 0.99
R4025:Fam208b UTSW 13 3,584,554 (GRCm38) missense probably damaging 0.99
R4308:Fam208b UTSW 13 3,569,498 (GRCm38) missense probably damaging 0.97
R4484:Fam208b UTSW 13 3,581,831 (GRCm38) missense probably benign 0.12
R4674:Fam208b UTSW 13 3,573,686 (GRCm38) missense possibly damaging 0.69
R4718:Fam208b UTSW 13 3,574,495 (GRCm38) missense probably benign 0.00
R4745:Fam208b UTSW 13 3,590,069 (GRCm38) missense probably benign 0.26
R4776:Fam208b UTSW 13 3,570,391 (GRCm38) missense probably damaging 1.00
R4839:Fam208b UTSW 13 3,584,807 (GRCm38) missense probably damaging 0.96
R4855:Fam208b UTSW 13 3,566,680 (GRCm38) splice site probably null
R5049:Fam208b UTSW 13 3,574,000 (GRCm38) missense probably benign 0.00
R5076:Fam208b UTSW 13 3,576,357 (GRCm38) missense probably benign 0.41
R5287:Fam208b UTSW 13 3,575,744 (GRCm38) missense probably benign 0.41
R5298:Fam208b UTSW 13 3,595,613 (GRCm38) splice site probably null
R5379:Fam208b UTSW 13 3,588,496 (GRCm38) missense probably benign 0.41
R5512:Fam208b UTSW 13 3,595,517 (GRCm38) missense probably damaging 0.99
R5624:Fam208b UTSW 13 3,584,996 (GRCm38) missense possibly damaging 0.66
R5750:Fam208b UTSW 13 3,573,642 (GRCm38) nonsense probably null
R6114:Fam208b UTSW 13 3,590,081 (GRCm38) missense probably damaging 1.00
R6118:Fam208b UTSW 13 3,581,891 (GRCm38) missense possibly damaging 0.76
R6119:Fam208b UTSW 13 3,581,891 (GRCm38) missense possibly damaging 0.76
R6269:Fam208b UTSW 13 3,581,891 (GRCm38) missense possibly damaging 0.76
R6270:Fam208b UTSW 13 3,581,891 (GRCm38) missense possibly damaging 0.76
R6271:Fam208b UTSW 13 3,581,891 (GRCm38) missense possibly damaging 0.76
R6272:Fam208b UTSW 13 3,581,891 (GRCm38) missense possibly damaging 0.76
R6525:Fam208b UTSW 13 3,576,540 (GRCm38) nonsense probably null
R6550:Fam208b UTSW 13 3,590,519 (GRCm38) missense possibly damaging 0.85
R6714:Fam208b UTSW 13 3,594,189 (GRCm38) missense probably benign 0.00
R6797:Fam208b UTSW 13 3,576,769 (GRCm38) missense probably benign 0.26
R6967:Fam208b UTSW 13 3,574,819 (GRCm38) missense probably benign 0.22
R7016:Fam208b UTSW 13 3,576,857 (GRCm38) missense possibly damaging 0.92
R7219:Fam208b UTSW 13 3,590,521 (GRCm38) missense probably damaging 0.99
R7454:Fam208b UTSW 13 3,585,332 (GRCm38) missense probably benign 0.21
R7570:Fam208b UTSW 13 3,573,621 (GRCm38) missense probably damaging 0.99
R7571:Fam208b UTSW 13 3,575,292 (GRCm38) missense probably benign 0.01
R7580:Fam208b UTSW 13 3,574,752 (GRCm38) missense probably damaging 0.99
R7587:Fam208b UTSW 13 3,568,849 (GRCm38) missense possibly damaging 0.83
R7657:Fam208b UTSW 13 3,573,777 (GRCm38) missense probably damaging 0.98
R7810:Fam208b UTSW 13 3,575,714 (GRCm38) missense possibly damaging 0.61
R7909:Fam208b UTSW 13 3,573,765 (GRCm38) missense possibly damaging 0.93
R7924:Fam208b UTSW 13 3,594,331 (GRCm38) missense possibly damaging 0.92
R7945:Fam208b UTSW 13 3,576,085 (GRCm38) missense probably benign
R8005:Fam208b UTSW 13 3,575,681 (GRCm38) missense probably benign
R8067:Fam208b UTSW 13 3,569,602 (GRCm38) missense probably benign
R8112:Fam208b UTSW 13 3,569,516 (GRCm38) missense probably damaging 1.00
R8162:Fam208b UTSW 13 3,599,691 (GRCm38) missense probably damaging 0.96
R8170:Fam208b UTSW 13 3,574,881 (GRCm38) nonsense probably null
R8240:Fam208b UTSW 13 3,574,388 (GRCm38) missense probably benign
R8263:Fam208b UTSW 13 3,590,016 (GRCm38) missense probably benign 0.03
R8263:Fam208b UTSW 13 3,575,286 (GRCm38) missense possibly damaging 0.70
R8477:Fam208b UTSW 13 3,575,079 (GRCm38) missense probably benign 0.18
R9022:Fam208b UTSW 13 3,576,659 (GRCm38) missense probably benign
R9140:Fam208b UTSW 13 3,588,441 (GRCm38) missense probably benign 0.04
R9167:Fam208b UTSW 13 3,574,724 (GRCm38) missense probably benign
R9527:Fam208b UTSW 13 3,585,191 (GRCm38) missense possibly damaging 0.61
R9535:Fam208b UTSW 13 3,573,559 (GRCm38) missense possibly damaging 0.69
R9711:Fam208b UTSW 13 3,599,667 (GRCm38) missense probably benign
X0024:Fam208b UTSW 13 3,599,837 (GRCm38) missense probably null 0.99
X0025:Fam208b UTSW 13 3,576,827 (GRCm38) missense probably benign 0.15
X0066:Fam208b UTSW 13 3,588,441 (GRCm38) missense probably benign 0.04
Z1176:Fam208b UTSW 13 3,588,429 (GRCm38) missense probably damaging 0.98
Z1176:Fam208b UTSW 13 3,576,636 (GRCm38) missense probably benign 0.01
Z1177:Fam208b UTSW 13 3,574,234 (GRCm38) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTGACATTTGGGGATGCCATC -3'
(R):5'- TTCTGCAGAAGCTGTGTTCC -3'

Sequencing Primer
(F):5'- ACATTTGGGGATGCCATCATTTG -3'
(R):5'- TGTGTTCCAGGAGGCATACCAG -3'
Posted On 2015-04-30