Incidental Mutation 'R4058:Usp45'
ID314328
Institutional Source Beutler Lab
Gene Symbol Usp45
Ensembl Gene ENSMUSG00000040455
Gene Nameubiquitin specific petidase 45
SynonymsGcap7, 3110003C05Rik, 4930550B20Rik
MMRRC Submission 040969-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4058 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location21767156-21837872 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21810746 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 314 (I314T)
Ref Sequence ENSEMBL: ENSMUSP00000103867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040429] [ENSMUST00000065111] [ENSMUST00000108232] [ENSMUST00000148647]
Predicted Effect probably damaging
Transcript: ENSMUST00000040429
AA Change: I314T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048324
Gene: ENSMUSG00000040455
AA Change: I314T

DomainStartEndE-ValueType
Pfam:zf-UBP 60 139 2e-19 PFAM
Pfam:UCH 190 761 2.8e-50 PFAM
Pfam:UCH_1 533 743 3.9e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000065111
AA Change: I314T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067109
Gene: ENSMUSG00000040455
AA Change: I314T

DomainStartEndE-ValueType
Pfam:zf-UBP 60 139 4.1e-19 PFAM
Pfam:UCH 190 809 2.1e-45 PFAM
Pfam:UCH_1 581 790 9.6e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108232
AA Change: I314T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103867
Gene: ENSMUSG00000040455
AA Change: I314T

DomainStartEndE-ValueType
Pfam:zf-UBP 60 139 2.2e-19 PFAM
Pfam:UCH 190 809 4.6e-50 PFAM
Pfam:UCH_1 582 791 4.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137293
SMART Domains Protein: ENSMUSP00000125982
Gene: ENSMUSG00000040455

DomainStartEndE-ValueType
Pfam:zf-UBP 27 106 1.6e-20 PFAM
Pfam:UCH 157 205 3.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148647
AA Change: Y149H

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000128859
Gene: ENSMUSG00000040455
AA Change: Y149H

DomainStartEndE-ValueType
Pfam:UCH 54 150 4.6e-9 PFAM
Meta Mutation Damage Score 0.3696 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 88% (38/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a deubiquitylase that binds ERCC1, the catalytic subunit of the XPF-ERCC1 DNA repair endonuclease. This endonuclease is a critical regulator of DNA repair processes, and the deubiquitylase activity of the encoded protein is important for maintaining the DNA repair ability of XPF-ERCC1. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,766,458 V301A probably benign Het
Adam15 A G 3: 89,347,055 V145A possibly damaging Het
Anxa4 C T 6: 86,757,818 probably null Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Atp13a3 C A 16: 30,354,246 C271F possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
C130060K24Rik T A 6: 65,381,541 I83N probably damaging Het
Cldn34c4 C A X: 127,721,437 V137F probably benign Het
Cngb1 T C 8: 95,267,654 E163G probably benign Het
Dync1i1 A G 6: 5,769,764 D113G probably damaging Het
Etl4 T A 2: 20,806,019 V971D possibly damaging Het
Gys1 A G 7: 45,448,386 probably benign Het
H13 C G 2: 152,691,874 P227R probably damaging Het
Ift22 C A 5: 136,911,863 P84Q unknown Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Kdm8 T A 7: 125,456,494 Y65N probably damaging Het
Lbp T A 2: 158,324,630 V368E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Megf6 T C 4: 154,242,532 probably benign Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mitd1 C T 1: 37,881,026 S167N probably benign Het
Mon2 A G 10: 123,002,819 V1593A probably benign Het
Nkx3-2 T A 5: 41,762,063 E194V possibly damaging Het
Nup210 A T 6: 91,060,620 V757D probably benign Het
Olfr1031 T A 2: 85,992,232 S138R possibly damaging Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Opcml A G 9: 28,901,588 Y192C probably damaging Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Pkd2l2 T C 18: 34,428,192 F418L probably benign Het
Plekhg1 A G 10: 3,957,087 D668G probably damaging Het
Prep G A 10: 45,158,371 V660M probably benign Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Rhbdd1 A G 1: 82,370,381 N235D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sgo2b A T 8: 63,926,947 D950E probably damaging Het
Slc1a5 T C 7: 16,795,853 V399A probably damaging Het
Spag16 A T 1: 69,853,328 Q89H probably damaging Het
Spta1 T C 1: 174,241,137 W2168R probably damaging Het
Taok1 T A 11: 77,549,438 K581M probably benign Het
Tns3 T C 11: 8,492,275 D696G probably damaging Het
Tspan8 C T 10: 115,835,282 R115* probably null Het
Txnrd1 A G 10: 82,885,280 E510G probably benign Het
Vmn2r15 T A 5: 109,293,446 H182L probably damaging Het
Vmn2r76 A C 7: 86,230,300 M264R probably benign Het
Other mutations in Usp45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02040:Usp45 APN 4 21830433 missense probably benign 0.38
IGL02053:Usp45 APN 4 21824553 missense probably benign 0.43
IGL02155:Usp45 APN 4 21798743 splice site probably null
R0285:Usp45 UTSW 4 21798603 critical splice acceptor site probably null
R1260:Usp45 UTSW 4 21826204 missense probably damaging 1.00
R1495:Usp45 UTSW 4 21797385 missense possibly damaging 0.82
R1888:Usp45 UTSW 4 21784811 intron probably benign
R2444:Usp45 UTSW 4 21817528 missense probably benign 0.00
R2906:Usp45 UTSW 4 21834338 nonsense probably null
R4357:Usp45 UTSW 4 21834350 nonsense probably null
R4386:Usp45 UTSW 4 21830505 critical splice donor site probably null
R4648:Usp45 UTSW 4 21825044 missense probably benign 0.12
R4766:Usp45 UTSW 4 21797307 missense probably damaging 0.98
R4787:Usp45 UTSW 4 21796860 missense probably benign
R4973:Usp45 UTSW 4 21815372 missense probably damaging 1.00
R5152:Usp45 UTSW 4 21824815 missense probably benign 0.41
R5900:Usp45 UTSW 4 21830451 missense probably damaging 1.00
R5960:Usp45 UTSW 4 21810797 missense probably damaging 1.00
R5961:Usp45 UTSW 4 21810797 missense probably damaging 1.00
R6149:Usp45 UTSW 4 21810797 missense probably damaging 1.00
R6150:Usp45 UTSW 4 21810797 missense probably damaging 1.00
R6151:Usp45 UTSW 4 21810797 missense probably damaging 1.00
R6997:Usp45 UTSW 4 21781844 missense probably damaging 1.00
R7504:Usp45 UTSW 4 21816892 missense possibly damaging 0.65
R7565:Usp45 UTSW 4 21784790 missense probably benign 0.00
R7750:Usp45 UTSW 4 21780430 missense probably damaging 1.00
R7992:Usp45 UTSW 4 21824543 missense probably benign 0.02
R8043:Usp45 UTSW 4 21824543 missense probably benign 0.02
R8233:Usp45 UTSW 4 21781736 missense probably benign 0.33
R8237:Usp45 UTSW 4 21834274 missense probably damaging 0.98
Z1176:Usp45 UTSW 4 21796847 missense possibly damaging 0.87
Z1176:Usp45 UTSW 4 21817613 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TCGGCAAGGCTCAGTCTTAC -3'
(R):5'- GAAGGAGAGGCTTTACGACC -3'

Sequencing Primer
(F):5'- GGCAAGGCTCAGTCTTACAAAAC -3'
(R):5'- TGCAGAGGAAGGTGTTCTCCAAC -3'
Posted On2015-04-30