Incidental Mutation 'R4058:Taok1'
ID314353
Institutional Source Beutler Lab
Gene Symbol Taok1
Ensembl Gene ENSMUSG00000017291
Gene NameTAO kinase 1
SynonymsD130018F14Rik, 2810468K05Rik
MMRRC Submission 040969-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.703) question?
Stock #R4058 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location77529162-77607815 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77549438 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 581 (K581M)
Ref Sequence ENSEMBL: ENSMUSP00000055470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017435] [ENSMUST00000058496]
Predicted Effect probably benign
Transcript: ENSMUST00000017435
AA Change: K581M

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000017435
Gene: ENSMUSG00000017291
AA Change: K581M

DomainStartEndE-ValueType
S_TKc 28 281 3.26e-87 SMART
low complexity region 327 335 N/A INTRINSIC
low complexity region 350 370 N/A INTRINSIC
coiled coil region 458 651 N/A INTRINSIC
coiled coil region 792 878 N/A INTRINSIC
low complexity region 914 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058496
AA Change: K581M

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000055470
Gene: ENSMUSG00000017291
AA Change: K581M

DomainStartEndE-ValueType
S_TKc 28 281 3.26e-87 SMART
low complexity region 327 335 N/A INTRINSIC
low complexity region 350 370 N/A INTRINSIC
coiled coil region 458 651 N/A INTRINSIC
coiled coil region 792 878 N/A INTRINSIC
low complexity region 914 930 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 88% (38/43)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,766,458 V301A probably benign Het
Adam15 A G 3: 89,347,055 V145A possibly damaging Het
Anxa4 C T 6: 86,757,818 probably null Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Atp13a3 C A 16: 30,354,246 C271F possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
C130060K24Rik T A 6: 65,381,541 I83N probably damaging Het
Cldn34c4 C A X: 127,721,437 V137F probably benign Het
Cngb1 T C 8: 95,267,654 E163G probably benign Het
Dync1i1 A G 6: 5,769,764 D113G probably damaging Het
Etl4 T A 2: 20,806,019 V971D possibly damaging Het
Gys1 A G 7: 45,448,386 probably benign Het
H13 C G 2: 152,691,874 P227R probably damaging Het
Ift22 C A 5: 136,911,863 P84Q unknown Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Kdm8 T A 7: 125,456,494 Y65N probably damaging Het
Lbp T A 2: 158,324,630 V368E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Megf6 T C 4: 154,242,532 probably benign Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mitd1 C T 1: 37,881,026 S167N probably benign Het
Mon2 A G 10: 123,002,819 V1593A probably benign Het
Nkx3-2 T A 5: 41,762,063 E194V possibly damaging Het
Nup210 A T 6: 91,060,620 V757D probably benign Het
Olfr1031 T A 2: 85,992,232 S138R possibly damaging Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Opcml A G 9: 28,901,588 Y192C probably damaging Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Pkd2l2 T C 18: 34,428,192 F418L probably benign Het
Plekhg1 A G 10: 3,957,087 D668G probably damaging Het
Prep G A 10: 45,158,371 V660M probably benign Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Rhbdd1 A G 1: 82,370,381 N235D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sgo2b A T 8: 63,926,947 D950E probably damaging Het
Slc1a5 T C 7: 16,795,853 V399A probably damaging Het
Spag16 A T 1: 69,853,328 Q89H probably damaging Het
Spta1 T C 1: 174,241,137 W2168R probably damaging Het
Tns3 T C 11: 8,492,275 D696G probably damaging Het
Tspan8 C T 10: 115,835,282 R115* probably null Het
Txnrd1 A G 10: 82,885,280 E510G probably benign Het
Usp45 T C 4: 21,810,746 I314T probably damaging Het
Vmn2r15 T A 5: 109,293,446 H182L probably damaging Het
Vmn2r76 A C 7: 86,230,300 M264R probably benign Het
Other mutations in Taok1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Taok1 APN 11 77571684 missense probably damaging 1.00
IGL01629:Taok1 APN 11 77538204 missense possibly damaging 0.63
IGL02198:Taok1 APN 11 77575677 splice site probably benign
IGL02392:Taok1 APN 11 77549352 missense probably benign 0.13
IGL02415:Taok1 APN 11 77540240 unclassified probably benign
IGL02428:Taok1 APN 11 77549277 missense probably benign 0.01
IGL02972:Taok1 APN 11 77559758 missense probably benign 0.04
IGL03200:Taok1 APN 11 77575652 nonsense probably null
IGL03203:Taok1 APN 11 77540085 missense probably damaging 0.96
IGL03292:Taok1 APN 11 77540136 missense probably benign 0.07
IGL03351:Taok1 APN 11 77560328 missense probably damaging 0.96
R0070:Taok1 UTSW 11 77553717 missense probably benign
R0497:Taok1 UTSW 11 77573804 missense probably damaging 0.97
R0535:Taok1 UTSW 11 77553704 missense probably benign 0.00
R0558:Taok1 UTSW 11 77559844 missense possibly damaging 0.89
R0653:Taok1 UTSW 11 77578724 critical splice donor site probably null
R1249:Taok1 UTSW 11 77571637 missense probably damaging 1.00
R1424:Taok1 UTSW 11 77549364 missense probably benign 0.00
R1597:Taok1 UTSW 11 77579800 missense probably benign 0.31
R2112:Taok1 UTSW 11 77571646 missense probably benign 0.01
R3716:Taok1 UTSW 11 77541810 missense probably benign 0.09
R4013:Taok1 UTSW 11 77559833 missense possibly damaging 0.95
R4831:Taok1 UTSW 11 77553674 missense probably null 0.34
R5036:Taok1 UTSW 11 77549331 missense probably benign 0.01
R5917:Taok1 UTSW 11 77560318 missense probably damaging 0.99
R6271:Taok1 UTSW 11 77573783 missense probably damaging 1.00
R6286:Taok1 UTSW 11 77553773 missense probably benign 0.00
R6860:Taok1 UTSW 11 77541801 missense probably benign 0.01
R6933:Taok1 UTSW 11 77555653 missense probably benign
R7139:Taok1 UTSW 11 77571633 missense probably damaging 1.00
R7143:Taok1 UTSW 11 77537988 missense probably benign
R7305:Taok1 UTSW 11 77541674 nonsense probably null
R7340:Taok1 UTSW 11 77579817 missense possibly damaging 0.89
R7508:Taok1 UTSW 11 77545326 missense probably damaging 0.97
R7569:Taok1 UTSW 11 77555614 missense probably benign 0.06
R7753:Taok1 UTSW 11 77537899 missense probably benign 0.29
R8064:Taok1 UTSW 11 77549304 nonsense probably null
Z1176:Taok1 UTSW 11 77559926 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACAGAGTAAGGCATTGCTGAAAAC -3'
(R):5'- TGGTCTTTTAAAGCCAGGAACTATG -3'

Sequencing Primer
(F):5'- CATTTAAATGTACATACCTCCCTGAC -3'
(R):5'- GCCAGGAACTATGAAAATTAAATTGC -3'
Posted On2015-04-30