Incidental Mutation 'R4058:Dync1i1'
ID314334
Institutional Source Beutler Lab
Gene Symbol Dync1i1
Ensembl Gene ENSMUSG00000029757
Gene Namedynein cytoplasmic 1 intermediate chain 1
SynonymsIC74, Dncic1, DIC
MMRRC Submission 040969-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.707) question?
Stock #R4058 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location5725639-6028039 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5769764 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 113 (D113G)
Ref Sequence ENSEMBL: ENSMUSP00000111217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115554] [ENSMUST00000115555] [ENSMUST00000115556] [ENSMUST00000115559] [ENSMUST00000153942]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115554
AA Change: D96G

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111216
Gene: ENSMUSG00000029757
AA Change: D96G

DomainStartEndE-ValueType
coiled coil region 1 44 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:Dynein_IC2 105 137 3.1e-20 PFAM
low complexity region 143 150 N/A INTRINSIC
Blast:WD40 235 288 2e-26 BLAST
WD40 293 332 9.6e-2 SMART
WD40 339 382 8.91e-1 SMART
WD40 436 481 4.48e-2 SMART
WD40 484 524 6.19e-1 SMART
WD40 529 569 7.67e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115555
AA Change: D113G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111217
Gene: ENSMUSG00000029757
AA Change: D113G

DomainStartEndE-ValueType
coiled coil region 1 44 N/A INTRINSIC
low complexity region 92 107 N/A INTRINSIC
Pfam:Dynein_IC2 143 173 6.9e-18 PFAM
low complexity region 180 187 N/A INTRINSIC
Blast:WD40 272 325 4e-26 BLAST
WD40 330 369 9.6e-2 SMART
WD40 376 419 8.91e-1 SMART
WD40 473 518 4.48e-2 SMART
WD40 521 561 6.19e-1 SMART
WD40 566 606 7.67e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115556
AA Change: D85G

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111218
Gene: ENSMUSG00000029757
AA Change: D85G

DomainStartEndE-ValueType
coiled coil region 1 44 N/A INTRINSIC
Pfam:Dynein_IC2 114 146 9.2e-21 PFAM
low complexity region 152 159 N/A INTRINSIC
Blast:WD40 245 297 3e-26 BLAST
WD40 302 341 9.6e-2 SMART
WD40 348 391 8.91e-1 SMART
WD40 445 490 4.48e-2 SMART
WD40 493 533 6.19e-1 SMART
WD40 538 578 7.67e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115559
AA Change: D96G

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111221
Gene: ENSMUSG00000029757
AA Change: D96G

DomainStartEndE-ValueType
coiled coil region 1 44 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:Dynein_IC2 125 157 2e-20 PFAM
low complexity region 163 170 N/A INTRINSIC
Blast:WD40 256 308 3e-26 BLAST
WD40 313 352 9.6e-2 SMART
WD40 359 402 8.91e-1 SMART
WD40 456 501 4.48e-2 SMART
WD40 504 544 6.19e-1 SMART
WD40 549 589 7.67e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153942
SMART Domains Protein: ENSMUSP00000121787
Gene: ENSMUSG00000029757

DomainStartEndE-ValueType
coiled coil region 45 91 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000204149
AA Change: D74G
Meta Mutation Damage Score 0.0960 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 88% (38/43)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,766,458 V301A probably benign Het
Adam15 A G 3: 89,347,055 V145A possibly damaging Het
Anxa4 C T 6: 86,757,818 probably null Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Atp13a3 C A 16: 30,354,246 C271F possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
C130060K24Rik T A 6: 65,381,541 I83N probably damaging Het
Cldn34c4 C A X: 127,721,437 V137F probably benign Het
Cngb1 T C 8: 95,267,654 E163G probably benign Het
Etl4 T A 2: 20,806,019 V971D possibly damaging Het
Gys1 A G 7: 45,448,386 probably benign Het
H13 C G 2: 152,691,874 P227R probably damaging Het
Ift22 C A 5: 136,911,863 P84Q unknown Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Kdm8 T A 7: 125,456,494 Y65N probably damaging Het
Lbp T A 2: 158,324,630 V368E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Megf6 T C 4: 154,242,532 probably benign Het
Mettl13 G T 1: 162,546,186 H165Q probably damaging Het
Mitd1 C T 1: 37,881,026 S167N probably benign Het
Mon2 A G 10: 123,002,819 V1593A probably benign Het
Nkx3-2 T A 5: 41,762,063 E194V possibly damaging Het
Nup210 A T 6: 91,060,620 V757D probably benign Het
Olfr1031 T A 2: 85,992,232 S138R possibly damaging Het
Olfr1328 T C 4: 118,934,683 D53G probably damaging Het
Opcml A G 9: 28,901,588 Y192C probably damaging Het
Pcdha2 A G 18: 36,939,882 S189G probably benign Het
Pkd2l2 T C 18: 34,428,192 F418L probably benign Het
Plekhg1 A G 10: 3,957,087 D668G probably damaging Het
Prep G A 10: 45,158,371 V660M probably benign Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Rhbdd1 A G 1: 82,370,381 N235D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sgo2b A T 8: 63,926,947 D950E probably damaging Het
Slc1a5 T C 7: 16,795,853 V399A probably damaging Het
Spag16 A T 1: 69,853,328 Q89H probably damaging Het
Spta1 T C 1: 174,241,137 W2168R probably damaging Het
Taok1 T A 11: 77,549,438 K581M probably benign Het
Tns3 T C 11: 8,492,275 D696G probably damaging Het
Tspan8 C T 10: 115,835,282 R115* probably null Het
Txnrd1 A G 10: 82,885,280 E510G probably benign Het
Usp45 T C 4: 21,810,746 I314T probably damaging Het
Vmn2r15 T A 5: 109,293,446 H182L probably damaging Het
Vmn2r76 A C 7: 86,230,300 M264R probably benign Het
Other mutations in Dync1i1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Dync1i1 APN 6 5972135 missense probably damaging 1.00
IGL01816:Dync1i1 APN 6 5767146 critical splice donor site probably null
IGL02171:Dync1i1 APN 6 5969498 missense probably damaging 0.98
IGL02646:Dync1i1 APN 6 5767034 missense probably benign 0.12
IGL02672:Dync1i1 APN 6 5767034 missense probably benign 0.12
IGL02691:Dync1i1 APN 6 5800767 splice site probably benign
IGL02880:Dync1i1 APN 6 5966821 splice site probably null
IGL02796:Dync1i1 UTSW 6 5757385 missense probably benign 0.00
R0519:Dync1i1 UTSW 6 6027399 missense probably benign
R1404:Dync1i1 UTSW 6 5915876 missense probably damaging 1.00
R1404:Dync1i1 UTSW 6 5915876 missense probably damaging 1.00
R1499:Dync1i1 UTSW 6 5769799 splice site probably benign
R2119:Dync1i1 UTSW 6 5767096 missense probably damaging 0.97
R3177:Dync1i1 UTSW 6 5972211 critical splice donor site probably null
R3277:Dync1i1 UTSW 6 5972211 critical splice donor site probably null
R4028:Dync1i1 UTSW 6 5961842 missense probably damaging 1.00
R4551:Dync1i1 UTSW 6 5923206 missense probably benign 0.01
R4748:Dync1i1 UTSW 6 5767048 missense possibly damaging 0.66
R5263:Dync1i1 UTSW 6 5969446 missense possibly damaging 0.88
R6193:Dync1i1 UTSW 6 5730679 missense probably benign 0.03
R6280:Dync1i1 UTSW 6 5972084 missense probably benign 0.00
R6933:Dync1i1 UTSW 6 5913333 missense probably damaging 1.00
R7083:Dync1i1 UTSW 6 5969429 missense probably damaging 1.00
R7347:Dync1i1 UTSW 6 5784530 makesense probably null
R7512:Dync1i1 UTSW 6 5969410 missense possibly damaging 0.88
R7543:Dync1i1 UTSW 6 5784464 missense possibly damaging 0.93
R7601:Dync1i1 UTSW 6 5905129 missense probably benign 0.19
R8349:Dync1i1 UTSW 6 5966815 missense possibly damaging 0.88
R8449:Dync1i1 UTSW 6 5966815 missense possibly damaging 0.88
R8518:Dync1i1 UTSW 6 5913330 missense probably damaging 0.97
X0010:Dync1i1 UTSW 6 5972141 missense probably benign 0.06
Z1177:Dync1i1 UTSW 6 5767057 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCACTTTAATTTGGGCCCG -3'
(R):5'- CATGGTCTTTATGAGCCAACTC -3'

Sequencing Primer
(F):5'- CCGTTTGTTTTGATTTGTCTGACAC -3'
(R):5'- GTGGTCACAAGAACCATTCTGTC -3'
Posted On2015-04-30