Incidental Mutation 'R4091:Ttc23l'
ID317636
Institutional Source Beutler Lab
Gene Symbol Ttc23l
Ensembl Gene ENSMUSG00000022249
Gene Nametetratricopeptide repeat domain 23-like
Synonyms4930401A09Rik
MMRRC Submission 041626-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R4091 (G1)
Quality Score217
Status Validated
Chromosome15
Chromosomal Location10500102-10558668 bp(-) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) CT to CTTGGATT at 10537562 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022857] [ENSMUST00000166039] [ENSMUST00000167842] [ENSMUST00000167842]
Predicted Effect probably benign
Transcript: ENSMUST00000022857
SMART Domains Protein: ENSMUSP00000022857
Gene: ENSMUSG00000022249

DomainStartEndE-ValueType
TPR 159 192 4.21e1 SMART
Blast:TPR 208 239 2e-6 BLAST
TPR 250 283 1.4e1 SMART
low complexity region 292 303 N/A INTRINSIC
TPR 376 409 9.53e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166039
SMART Domains Protein: ENSMUSP00000131180
Gene: ENSMUSG00000022249

DomainStartEndE-ValueType
Blast:TPR 183 209 9e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000167842
SMART Domains Protein: ENSMUSP00000127781
Gene: ENSMUSG00000022249

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
Pfam:TPR_1 102 133 3.3e-6 PFAM
low complexity region 148 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167842
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,745,378 S674P possibly damaging Het
4932438A13Rik G A 3: 37,030,589 A3897T probably benign Het
A530099J19Rik T A 13: 19,729,465 noncoding transcript Het
Abca3 C T 17: 24,397,482 T966M probably damaging Het
Adam2 A T 14: 66,029,723 Y696N probably damaging Het
Aes G A 10: 81,565,584 G162D probably damaging Het
Alas1 G T 9: 106,241,801 probably null Het
Arhgap25 G T 6: 87,463,035 S543R probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Carns1 C T 19: 4,171,683 R191Q probably damaging Het
Casp8ap2 C A 4: 32,643,611 P895T probably damaging Het
Col12a1 T A 9: 79,702,364 I287F probably damaging Het
Cystm1 A G 18: 36,366,547 N5S unknown Het
Dnah8 T C 17: 30,769,839 V3261A probably damaging Het
Dnajc11 A G 4: 151,978,093 probably benign Het
Dock4 T C 12: 40,844,267 S1847P probably damaging Het
Dync2h1 A G 9: 7,131,881 V1642A probably benign Het
Eftud2 T C 11: 102,839,416 probably null Het
Fam221b A G 4: 43,665,987 I208T probably benign Het
Gpr37l1 T C 1: 135,161,563 I255V probably benign Het
Grm7 G A 6: 110,914,340 S178N probably damaging Het
Hspa12b T A 2: 131,133,488 probably null Het
Kctd3 A T 1: 188,995,720 probably benign Het
Kynu G A 2: 43,679,872 V389M possibly damaging Het
Lcat A G 8: 105,939,906 L328P probably benign Het
Lrrn2 C T 1: 132,937,652 Q152* probably null Het
Maml1 G A 11: 50,291,829 P78L probably benign Het
Mef2b G A 8: 70,165,102 V37M probably damaging Het
Mindy2 A T 9: 70,634,060 M281K probably damaging Het
Mon2 C T 10: 123,038,510 R311H probably damaging Het
Mtr A T 13: 12,231,057 V394E probably damaging Het
Myh14 T A 7: 44,632,991 T745S possibly damaging Het
Nme9 T A 9: 99,464,527 D131E possibly damaging Het
Nphp4 C A 4: 152,547,018 Q792K probably damaging Het
Nrxn2 T A 19: 6,473,414 C479S probably damaging Het
Nsmf T C 2: 25,060,859 I406T probably damaging Het
Olfr1431 A T 19: 12,209,779 D71V probably damaging Het
Olfr517 G A 7: 108,868,443 A237V probably damaging Het
Olfr945 T A 9: 39,258,034 I213F possibly damaging Het
Pbrm1 A G 14: 31,036,003 T197A probably benign Het
Pla2r1 T A 2: 60,432,593 N1034I probably damaging Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rxfp1 A T 3: 79,644,761 D744E probably benign Het
Samd9l T C 6: 3,376,887 N125D probably benign Het
Serpina3a G A 12: 104,116,366 V133I probably benign Het
Slc22a30 C T 19: 8,404,545 V121M probably damaging Het
Smarcc1 T A 9: 110,164,829 D247E possibly damaging Het
Smg9 T A 7: 24,420,867 L422Q probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Utrn T A 10: 12,710,171 D954V probably benign Het
Vmn1r227 T A 17: 20,735,516 noncoding transcript Het
Vmn2r11 A C 5: 109,054,750 probably null Het
Vmn2r84 A T 10: 130,391,369 M200K probably damaging Het
Vmn2r88 T A 14: 51,415,426 Y469N probably damaging Het
Wdcp A G 12: 4,855,279 N600S probably null Het
Wdfy4 T G 14: 33,125,880 R838S possibly damaging Het
Other mutations in Ttc23l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Ttc23l APN 15 10530689 missense probably damaging 1.00
IGL01319:Ttc23l APN 15 10509406 splice site probably benign
IGL01562:Ttc23l APN 15 10551390 splice site probably benign
IGL01969:Ttc23l APN 15 10551434 nonsense probably null
IGL03172:Ttc23l APN 15 10537566 missense probably benign 0.06
R0042:Ttc23l UTSW 15 10551541 missense probably damaging 1.00
R0042:Ttc23l UTSW 15 10551541 missense probably damaging 1.00
R0335:Ttc23l UTSW 15 10539963 missense probably benign 0.26
R0554:Ttc23l UTSW 15 10530657 missense probably benign 0.12
R0609:Ttc23l UTSW 15 10504536 missense probably benign
R0631:Ttc23l UTSW 15 10539980 missense probably damaging 1.00
R1703:Ttc23l UTSW 15 10523658 missense probably damaging 1.00
R2106:Ttc23l UTSW 15 10547256 missense probably damaging 1.00
R2220:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2276:Ttc23l UTSW 15 10523592 missense possibly damaging 0.92
R2277:Ttc23l UTSW 15 10523592 missense possibly damaging 0.92
R2278:Ttc23l UTSW 15 10523592 missense possibly damaging 0.92
R2279:Ttc23l UTSW 15 10523592 missense possibly damaging 0.92
R2368:Ttc23l UTSW 15 10537562 small insertion probably benign
R2368:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2420:Ttc23l UTSW 15 10537562 small insertion probably benign
R2420:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2421:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2422:Ttc23l UTSW 15 10537562 small insertion probably benign
R2422:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2830:Ttc23l UTSW 15 10537562 small insertion probably benign
R2831:Ttc23l UTSW 15 10537562 small insertion probably benign
R2831:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2979:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2980:Ttc23l UTSW 15 10537562 small insertion probably benign
R2980:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2981:Ttc23l UTSW 15 10537562 small insertion probably benign
R2981:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2982:Ttc23l UTSW 15 10537562 small insertion probably benign
R2982:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2983:Ttc23l UTSW 15 10537562 small insertion probably benign
R2983:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R3176:Ttc23l UTSW 15 10547232 missense possibly damaging 0.83
R3177:Ttc23l UTSW 15 10547232 missense possibly damaging 0.83
R3276:Ttc23l UTSW 15 10547232 missense possibly damaging 0.83
R3277:Ttc23l UTSW 15 10547232 missense possibly damaging 0.83
R3722:Ttc23l UTSW 15 10537562 small insertion probably benign
R3722:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R3743:Ttc23l UTSW 15 10537562 small insertion probably benign
R3743:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R3767:Ttc23l UTSW 15 10530695 missense possibly damaging 0.94
R3921:Ttc23l UTSW 15 10537562 small insertion probably benign
R3921:Ttc23l UTSW 15 10537563 small insertion probably benign
R3921:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4091:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4119:Ttc23l UTSW 15 10539920 missense probably damaging 1.00
R4120:Ttc23l UTSW 15 10539920 missense probably damaging 1.00
R4373:Ttc23l UTSW 15 10537562 small insertion probably benign
R4373:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4375:Ttc23l UTSW 15 10537562 small insertion probably benign
R4375:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4376:Ttc23l UTSW 15 10537562 small insertion probably benign
R4376:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4377:Ttc23l UTSW 15 10537562 small insertion probably benign
R4377:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R5002:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5106:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5107:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5109:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5156:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5157:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5160:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5161:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5259:Ttc23l UTSW 15 10515150 missense probably damaging 0.99
R5307:Ttc23l UTSW 15 10533659 missense probably damaging 1.00
R5728:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5756:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5772:Ttc23l UTSW 15 10551469 missense probably benign 0.01
R5793:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5794:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5847:Ttc23l UTSW 15 10537596 missense probably benign 0.07
R6976:Ttc23l UTSW 15 10537580 nonsense probably null
R7010:Ttc23l UTSW 15 10515138 missense probably damaging 1.00
R7342:Ttc23l UTSW 15 10551497 missense probably benign 0.01
R7404:Ttc23l UTSW 15 10551577 missense probably damaging 0.98
R7453:Ttc23l UTSW 15 10533767 missense probably damaging 1.00
R7584:Ttc23l UTSW 15 10533708 missense probably damaging 1.00
R7599:Ttc23l UTSW 15 10533680 missense possibly damaging 0.89
Z1088:Ttc23l UTSW 15 10533667 missense probably damaging 1.00
Z1177:Ttc23l UTSW 15 10533633 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATTAAACGTGGCAGCGTATATAG -3'
(R):5'- CTTGTTTTCCCAAGGGTCGC -3'

Sequencing Primer
(F):5'- GCAGCGTATATAGTAAGCTTGC -3'
(R):5'- CCCAAGGGTCGCTTTTGTTAGC -3'
Posted On2015-05-15