Mutagenetix > Incidental Mutation

Incidental Mutation 'R4093:Akap9'

317717

Institutional Source

Beutler Lab

Gene Symbol

Akap9

Ensembl Gene

ENSMUSG00000040407

Gene Name

A kinase (PRKA) anchor protein (yotiao) 9

Synonyms

AKAP450, G1-448-15, 5730481H23Rik, mei2-5, repro12

MMRRC Submission

041627-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.366) question?

Stock #

R4093 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3928054-4081310 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 4043996 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 2173 (M2173V)

Ref Sequence

ENSEMBL: ENSMUSP00000046129 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044492]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000044492
AA Change: M2173V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000046129
Gene: ENSMUSG00000040407
AA Change: M2173V

Domain	Start	End	E-Value	Type
low complexity region	9	18	N/A	INTRINSIC
low complexity region	33	44	N/A	INTRINSIC
low complexity region	98	115	N/A	INTRINSIC
Blast:HPT	126	197	6e-21	BLAST
low complexity region	237	249	N/A	INTRINSIC
low complexity region	297	315	N/A	INTRINSIC
coiled coil region	404	593	N/A	INTRINSIC
coiled coil region	622	756	N/A	INTRINSIC
coiled coil region	777	843	N/A	INTRINSIC
coiled coil region	888	958	N/A	INTRINSIC
low complexity region	982	997	N/A	INTRINSIC
coiled coil region	1037	1065	N/A	INTRINSIC
low complexity region	1233	1246	N/A	INTRINSIC
internal_repeat_2	1247	1312	7.75e-5	PROSPERO
internal_repeat_1	1377	1485	2.63e-5	PROSPERO
coiled coil region	1522	1589	N/A	INTRINSIC
coiled coil region	1789	2107	N/A	INTRINSIC
coiled coil region	2132	2318	N/A	INTRINSIC
internal_repeat_1	2322	2445	2.63e-5	PROSPERO
coiled coil region	2455	2494	N/A	INTRINSIC
low complexity region	2587	2598	N/A	INTRINSIC
low complexity region	2627	2640	N/A	INTRINSIC
internal_repeat_2	2934	2997	7.75e-5	PROSPERO
low complexity region	3000	3016	N/A	INTRINSIC
coiled coil region	3109	3307	N/A	INTRINSIC
coiled coil region	3455	3493	N/A	INTRINSIC
coiled coil region	3521	3556	N/A	INTRINSIC
Pfam:PACT_coil_coil	3576	3657	1.2e-27	PFAM

Meta Mutation Damage Score

0.1448

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

92% (69/75)

MGI Phenotype

PHENOTYPE: Mice homozygous for a chemically induced allele exhibit male infertily with abnormal spermatogenesis and Sertoli maturation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alas1	G	T	9: 106,241,801		probably null	Het
Angpt1	T	C	15: 42,523,545	T138A	probably damaging	Het
Atp2c2	G	A	8: 119,749,871		probably null	Het
C330027C09Rik	T	C	16: 49,000,976		probably benign	Het
Cadm2	A	G	16: 66,784,788	V210A	possibly damaging	Het
Cfap70	A	T	14: 20,409,113	D671E	probably damaging	Het
Chd2	C	T	7: 73,501,016	E322K	possibly damaging	Het
Chrnd	C	T	1: 87,191,007	Q29*	probably null	Het
Cym	A	G	3: 107,214,266	S237P	probably benign	Het
D030068K23Rik	A	G	8: 109,251,459		noncoding transcript	Het
Gsdma2	T	A	11: 98,650,851	S135T	probably benign	Het
Hc	A	T	2: 34,983,807	Y158*	probably null	Het
Hoxb3	C	A	11: 96,346,100	H335N	probably damaging	Het
Htr2a	G	A	14: 74,706,349	M456I	probably benign	Het
Ighv1-19	G	A	12: 114,708,730	T90I	probably damaging	Het
Kansl3	C	A	1: 36,344,954	S729I	probably damaging	Het
Kcnab1	T	C	3: 65,299,614	I137T	possibly damaging	Het
Kcnt1	A	T	2: 25,877,915	E12V	probably damaging	Het
Klk15	A	T	7: 43,938,780	S171C	possibly damaging	Het
Lcn2	A	T	2: 32,387,716	M1K	probably null	Het
Lrig1	T	C	6: 94,613,578	D487G	probably benign	Het
Lrp8	T	A	4: 107,843,271	C135*	probably null	Het
Lrrc31	C	A	3: 30,695,522	S54I	probably damaging	Het
Ltbp4	A	G	7: 27,325,216	V663A	possibly damaging	Het
Med27	G	A	2: 29,377,908		probably benign	Het
Mical1	T	C	10: 41,486,937		probably benign	Het
Myt1	A	T	2: 181,811,398	M799L	probably damaging	Het
Nlrc4	T	C	17: 74,445,958	M477V	probably benign	Het
Npy4r	T	C	14: 34,147,141	I63M	probably benign	Het
Olfr224	A	T	11: 58,566,829	I172N	probably damaging	Het
Olfr282	T	C	15: 98,437,682	L71P	probably damaging	Het
Olfr672	C	T	7: 104,996,635	G90S	probably benign	Het
Olfr904	T	A	9: 38,464,083	L14Q	probably null	Het
Piezo1	A	C	8: 122,501,160		probably null	Het
Ppp1r12c	T	C	7: 4,483,367	E601G	probably damaging	Het
Proser1	T	C	3: 53,479,712		probably null	Het
Psme2	A	T	14: 55,588,277	N143K	probably benign	Het
Pygo2	C	A	3: 89,433,264	P323Q	probably damaging	Het
Rab11b	T	C	17: 33,749,789	T77A	possibly damaging	Het
Recql5	A	G	11: 115,904,888	S190P	probably benign	Het
Serpina12	A	G	12: 104,037,924	F150L	probably damaging	Het
Sfswap	A	G	5: 129,560,741	S821G	possibly damaging	Het
Slc22a2	C	T	17: 12,612,394	T357M	probably damaging	Het
Spag6l	A	C	16: 16,829,024	N39K	probably benign	Het
Srl	A	G	16: 4,497,452	S109P	possibly damaging	Het
Tagap	A	T	17: 7,929,423	H152L	probably damaging	Het
Tbx3	T	A	5: 119,680,748	S463T	probably benign	Het
Tcaf2	A	G	6: 42,642,838	L85P	probably damaging	Het
Tenm4	A	T	7: 96,895,772	S2332C	probably damaging	Het
Trim60	A	T	8: 65,001,378	M73K	probably benign	Het
Trpc1	T	C	9: 95,706,865	T769A	probably benign	Het
Tubgcp4	T	A	2: 121,195,477	L601Q	probably benign	Het
Unc5d	T	C	8: 28,844,837	Y154C	possibly damaging	Het
Vmn1r185	A	T	7: 26,611,783	V99E	probably damaging	Het
Vmn1r57	G	T	7: 5,220,857	S127I	possibly damaging	Het
Vmn1r62	T	A	7: 5,675,944	M208K	probably damaging	Het
Vmn2r110	T	C	17: 20,583,380	D311G	possibly damaging	Het
Vmn2r48	C	A	7: 9,942,258	S432I	probably benign	Het
Vmn2r48	T	A	7: 9,942,259	S432C	probably damaging	Het
Vmn2r71	T	C	7: 85,621,234	V536A	probably benign	Het
Vstm2a	A	G	11: 16,259,884	T37A	probably damaging	Het
Wfs1	T	C	5: 36,967,465	H694R	probably damaging	Het
Zdbf2	T	C	1: 63,309,781	S2440P	possibly damaging	Het
Zfp61	A	G	7: 24,291,275		probably null	Het
Zfp64	T	C	2: 168,925,935	T586A	probably benign	Het
Zfp943	T	A	17: 21,992,982	C350S	probably damaging	Het

Other mutations in Akap9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00478:Akap9	APN	5	4046639	missense	probably damaging	0.97
IGL00642:Akap9	APN	5	3960842	missense	probably damaging	0.99
IGL00786:Akap9	APN	5	4070522	missense	probably damaging	1.00
IGL00788:Akap9	APN	5	4060480	missense	probably damaging	1.00
IGL00969:Akap9	APN	5	4001550	missense	probably benign
IGL01014:Akap9	APN	5	3968683	missense	probably benign	0.41
IGL01302:Akap9	APN	5	3970711	missense	probably benign	0.27
IGL01610:Akap9	APN	5	4032839	missense	possibly damaging	0.95
IGL01620:Akap9	APN	5	3960218	missense	probably benign	0.11
IGL01862:Akap9	APN	5	3951705	missense	probably damaging	0.99
IGL01862:Akap9	APN	5	4065856	missense	probably damaging	0.99
IGL02151:Akap9	APN	5	4032728	nonsense	probably null
IGL02635:Akap9	APN	5	4070500	missense	possibly damaging	0.59
IGL02858:Akap9	APN	5	4069130	missense	possibly damaging	0.88
IGL02967:Akap9	APN	5	3976164	missense	probably benign	0.07
IGL03064:Akap9	APN	5	3968755	missense	probably damaging	1.00
IGL03289:Akap9	APN	5	4077261	missense	probably damaging	1.00
Andy	UTSW	5	3961764	nonsense	probably null
blimey	UTSW	5	4070397	nonsense	probably null
hoarder	UTSW	5	4069089	missense	probably benign	0.00
marinarum	UTSW	5	4013875	nonsense	probably null
miser	UTSW	5	4046064	missense	probably benign	0.13
naviculus	UTSW	5	3960865	missense	probably damaging	0.98
thrifty	UTSW	5	3976209	missense	probably damaging	0.99
wee_one	UTSW	5	4043925	missense	probably damaging	1.00
FR4449:Akap9	UTSW	5	3981214	unclassified	probably benign
PIT1430001:Akap9	UTSW	5	4029849	missense	probably damaging	1.00
PIT4366001:Akap9	UTSW	5	4046221	missense	probably benign	0.24
R0088:Akap9	UTSW	5	3961946	missense	probably benign	0.22
R0309:Akap9	UTSW	5	4069038	missense	probably benign	0.01
R0387:Akap9	UTSW	5	3951678	splice site	probably benign
R0440:Akap9	UTSW	5	4064569	missense	probably damaging	0.99
R0441:Akap9	UTSW	5	3961714	missense	probably benign	0.15
R0491:Akap9	UTSW	5	3972851	unclassified	probably benign
R0501:Akap9	UTSW	5	3970685	missense	probably damaging	1.00
R0507:Akap9	UTSW	5	4069043	missense	probably benign	0.41
R0544:Akap9	UTSW	5	4069185	missense	probably benign	0.22
R0581:Akap9	UTSW	5	4050620	missense	probably benign	0.03
R0611:Akap9	UTSW	5	3954870	missense	probably benign	0.00
R0620:Akap9	UTSW	5	4064136	missense	probably damaging	0.98
R0639:Akap9	UTSW	5	4060318	missense	probably damaging	1.00
R0932:Akap9	UTSW	5	4046492	missense	possibly damaging	0.77
R0944:Akap9	UTSW	5	4064742	splice site	probably null
R1101:Akap9	UTSW	5	4046205	missense	probably benign	0.00
R1159:Akap9	UTSW	5	3960865	missense	probably damaging	0.98
R1170:Akap9	UTSW	5	4055671	missense	probably benign
R1185:Akap9	UTSW	5	3948783	missense	probably benign	0.13
R1185:Akap9	UTSW	5	3948783	missense	probably benign	0.13
R1185:Akap9	UTSW	5	3948783	missense	probably benign	0.13
R1453:Akap9	UTSW	5	3975614	splice site	probably null
R1551:Akap9	UTSW	5	4069174	missense	probably benign	0.02
R1608:Akap9	UTSW	5	3961783	missense	probably damaging	1.00
R1652:Akap9	UTSW	5	4077210	missense	probably damaging	1.00
R1659:Akap9	UTSW	5	4064633	missense	probably damaging	1.00
R1713:Akap9	UTSW	5	4039345	critical splice donor site	probably null
R1719:Akap9	UTSW	5	3957645	nonsense	probably null
R1720:Akap9	UTSW	5	3972791	missense	possibly damaging	0.63
R1757:Akap9	UTSW	5	4001667	missense	probably benign	0.41
R1872:Akap9	UTSW	5	4001406	missense	probably damaging	1.00
R1876:Akap9	UTSW	5	3961809	missense	probably benign	0.28
R1881:Akap9	UTSW	5	4050173	missense	probably benign
R1950:Akap9	UTSW	5	3960677	missense	probably damaging	1.00
R1980:Akap9	UTSW	5	3972771	missense	probably damaging	0.99
R1993:Akap9	UTSW	5	4038520	splice site	probably null
R2008:Akap9	UTSW	5	3960131	missense	possibly damaging	0.47
R2020:Akap9	UTSW	5	3961967	missense	probably damaging	1.00
R2051:Akap9	UTSW	5	3975685	nonsense	probably null
R2061:Akap9	UTSW	5	3961010	missense	probably damaging	1.00
R2109:Akap9	UTSW	5	4044847	missense	possibly damaging	0.47
R2135:Akap9	UTSW	5	4064509	missense	probably damaging	1.00
R2225:Akap9	UTSW	5	4077271	missense	probably damaging	0.96
R2232:Akap9	UTSW	5	4046603	missense	probably damaging	1.00
R2424:Akap9	UTSW	5	4065279	missense	probably damaging	0.97
R2483:Akap9	UTSW	5	3976235	missense	possibly damaging	0.65
R2879:Akap9	UTSW	5	3976353	intron	probably benign
R3622:Akap9	UTSW	5	3976235	missense	possibly damaging	0.65
R3623:Akap9	UTSW	5	3976235	missense	possibly damaging	0.65
R3624:Akap9	UTSW	5	3976235	missense	possibly damaging	0.65
R3722:Akap9	UTSW	5	4070351	missense	probably damaging	1.00
R3806:Akap9	UTSW	5	3954410	missense	probably benign	0.00
R3919:Akap9	UTSW	5	3961764	nonsense	probably null
R4023:Akap9	UTSW	5	3992077	missense	possibly damaging	0.66
R4434:Akap9	UTSW	5	4032708	missense	probably damaging	0.99
R4529:Akap9	UTSW	5	4043948	missense	probably damaging	1.00
R4530:Akap9	UTSW	5	4043948	missense	probably damaging	1.00
R4532:Akap9	UTSW	5	4043948	missense	probably damaging	1.00
R4533:Akap9	UTSW	5	4043948	missense	probably damaging	1.00
R4585:Akap9	UTSW	5	3976151	missense	probably benign	0.00
R4586:Akap9	UTSW	5	3976151	missense	probably benign	0.00
R4655:Akap9	UTSW	5	4046403	missense	probably benign	0.14
R4676:Akap9	UTSW	5	4032774	missense	probably damaging	1.00
R4676:Akap9	UTSW	5	4064515	nonsense	probably null
R4724:Akap9	UTSW	5	4055339	missense	probably benign
R4731:Akap9	UTSW	5	3962266	missense	possibly damaging	0.54
R4732:Akap9	UTSW	5	4013901	missense	probably damaging	0.98
R4733:Akap9	UTSW	5	4013901	missense	probably damaging	0.98
R4743:Akap9	UTSW	5	3961013	missense	probably damaging	1.00
R4749:Akap9	UTSW	5	3968737	missense	probably benign	0.41
R4756:Akap9	UTSW	5	4001418	missense	probably damaging	0.99
R4757:Akap9	UTSW	5	4008382	missense	probably damaging	1.00
R4860:Akap9	UTSW	5	4034916	intron	probably benign
R4937:Akap9	UTSW	5	4050145	splice site	probably null
R4960:Akap9	UTSW	5	3957664	missense	probably benign	0.15
R4974:Akap9	UTSW	5	3961466	missense	possibly damaging	0.81
R5101:Akap9	UTSW	5	4001748	missense	probably damaging	0.96
R5160:Akap9	UTSW	5	4030007	missense	probably damaging	1.00
R5200:Akap9	UTSW	5	3960734	missense	probably benign	0.00
R5245:Akap9	UTSW	5	3976209	missense	probably damaging	0.99
R5293:Akap9	UTSW	5	3948687	missense	probably damaging	0.99
R5408:Akap9	UTSW	5	4058458	missense	possibly damaging	0.84
R5507:Akap9	UTSW	5	3968683	missense	probably benign	0.41
R5517:Akap9	UTSW	5	4001665	missense	possibly damaging	0.76
R5579:Akap9	UTSW	5	4064714	missense	possibly damaging	0.93
R5619:Akap9	UTSW	5	3954760	intron	probably benign
R5645:Akap9	UTSW	5	4050590	missense	probably benign	0.09
R5669:Akap9	UTSW	5	4050540	nonsense	probably null
R5686:Akap9	UTSW	5	3971926	missense	probably benign	0.00
R5697:Akap9	UTSW	5	3960170	missense	possibly damaging	0.92
R5821:Akap9	UTSW	5	4046064	missense	probably benign	0.13
R5875:Akap9	UTSW	5	4077285	missense	probably benign	0.01
R5897:Akap9	UTSW	5	4077904	missense	probably benign	0.23
R5999:Akap9	UTSW	5	4043925	missense	probably damaging	1.00
R6025:Akap9	UTSW	5	4032801	missense	probably damaging	1.00
R6078:Akap9	UTSW	5	4067924	critical splice donor site	probably null
R6138:Akap9	UTSW	5	4067924	critical splice donor site	probably null
R6225:Akap9	UTSW	5	3962105	missense	probably damaging	1.00
R6243:Akap9	UTSW	5	4065000	splice site	probably null
R6326:Akap9	UTSW	5	3962061	missense	probably damaging	1.00
R6564:Akap9	UTSW	5	4028491	missense	probably damaging	0.98
R6617:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R6625:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R6632:Akap9	UTSW	5	4013842	splice site	probably null
R6677:Akap9	UTSW	5	4029869	missense	probably benign	0.21
R6717:Akap9	UTSW	5	4064086	missense	probably damaging	1.00
R6893:Akap9	UTSW	5	3961709	missense	probably benign	0.32
R6915:Akap9	UTSW	5	3960551	missense	probably benign	0.03
R6938:Akap9	UTSW	5	4046628	missense	possibly damaging	0.91
R6972:Akap9	UTSW	5	4046699	missense	possibly damaging	0.62
R6973:Akap9	UTSW	5	4046699	missense	possibly damaging	0.62
R6993:Akap9	UTSW	5	4065866	missense	possibly damaging	0.65
R7032:Akap9	UTSW	5	3954896	missense	probably benign
R7164:Akap9	UTSW	5	4060364	missense	probably damaging	0.96
R7170:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7192:Akap9	UTSW	5	4005723	splice site	probably null
R7284:Akap9	UTSW	5	3956246	missense	probably damaging	1.00
R7299:Akap9	UTSW	5	4032696	missense	probably damaging	1.00
R7313:Akap9	UTSW	5	4004933	missense	probably damaging	1.00
R7326:Akap9	UTSW	5	4045930	missense	possibly damaging	0.47
R7343:Akap9	UTSW	5	4046364	missense	probably damaging	0.99
R7455:Akap9	UTSW	5	3972792	missense	probably benign	0.03
R7482:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7489:Akap9	UTSW	5	4004933	missense	probably damaging	1.00
R7525:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7528:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7576:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7577:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7578:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7610:Akap9	UTSW	5	3957677	missense	possibly damaging	0.95
R7658:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7754:Akap9	UTSW	5	4046736	missense	probably benign	0.03
R7818:Akap9	UTSW	5	4013875	nonsense	probably null
R7979:Akap9	UTSW	5	4050381	missense	probably benign
R7991:Akap9	UTSW	5	4064949	splice site	probably null
R8036:Akap9	UTSW	5	4070397	nonsense	probably null
R8054:Akap9	UTSW	5	4038707	critical splice donor site	probably null
R8116:Akap9	UTSW	5	4061183	missense	probably benign	0.04
R8150:Akap9	UTSW	5	3961982	missense	probably damaging	1.00
R8234:Akap9	UTSW	5	4044845	missense	probably benign	0.18
R8348:Akap9	UTSW	5	3948897	critical splice donor site	probably null
R8365:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R8366:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R8448:Akap9	UTSW	5	3948897	critical splice donor site	probably null
R8466:Akap9	UTSW	5	4038659	missense	probably damaging	1.00
R8772:Akap9	UTSW	5	4046255	missense	probably damaging	1.00
R8881:Akap9	UTSW	5	3961279	missense
R8937:Akap9	UTSW	5	4044048	missense	possibly damaging	0.78
R8956:Akap9	UTSW	5	3948805	missense	possibly damaging	0.79
R9000:Akap9	UTSW	5	4055650	missense	probably benign
R9049:Akap9	UTSW	5	4064597	missense
R9074:Akap9	UTSW	5	4077959	missense	probably benign	0.40
R9124:Akap9	UTSW	5	4061284	missense	probably damaging	0.99
R9129:Akap9	UTSW	5	4069089	missense	probably benign	0.00
R9371:Akap9	UTSW	5	3961852	missense	possibly damaging	0.83
R9424:Akap9	UTSW	5	3962223	nonsense	probably null
R9424:Akap9	UTSW	5	3962224	nonsense	probably null
R9509:Akap9	UTSW	5	4046349	missense	probably benign
R9515:Akap9	UTSW	5	4055709	missense	probably damaging	1.00
R9567:Akap9	UTSW	5	4077311	missense	possibly damaging	0.89
R9587:Akap9	UTSW	5	4069149	missense	probably damaging	1.00
R9619:Akap9	UTSW	5	4044833	missense	probably damaging	1.00
R9635:Akap9	UTSW	5	4050545	missense	probably benign	0.20
R9680:Akap9	UTSW	5	3961587	missense	probably benign	0.03
R9691:Akap9	UTSW	5	3960491	missense	probably damaging	1.00
R9726:Akap9	UTSW	5	4003757	missense	probably benign	0.39
U15987:Akap9	UTSW	5	4067924	critical splice donor site	probably null
X0026:Akap9	UTSW	5	4014039	missense	probably damaging	1.00
X0057:Akap9	UTSW	5	3975598	critical splice acceptor site	probably null
Z1176:Akap9	UTSW	5	3962251	missense	probably damaging	0.96
Z1177:Akap9	UTSW	5	4046189	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATGTGTAAATGGTAATACATCCTTT -3'
(R):5'- GTCTAGGTTCAGTAGCAAACAGAAG -3'

Sequencing Primer
(F):5'- CATGGATAGGAACTGGCT -3'
(R):5'- CTTGTAAATAAATCCCAGGGCTCGG -3'

Posted On

2015-05-15