Incidental Mutation 'R4192:Vmn1r27'
ID318351
Institutional Source Beutler Lab
Gene Symbol Vmn1r27
Ensembl Gene ENSMUSG00000071428
Gene Namevomeronasal 1 receptor 27
SynonymsV1rc33
MMRRC Submission 041023-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R4192 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location58213091-58218821 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 58215827 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Arginine at position 14 (I14R)
Ref Sequence ENSEMBL: ENSMUSP00000154455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095862] [ENSMUST00000226666] [ENSMUST00000228530]
Predicted Effect probably damaging
Transcript: ENSMUST00000095862
AA Change: I64R

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093547
Gene: ENSMUSG00000071428
AA Change: I64R

DomainStartEndE-ValueType
Pfam:V1R 28 293 4.2e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226666
AA Change: I14R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000228530
AA Change: I64R

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 36,096,579 R178L possibly damaging Het
Acot4 T C 12: 84,043,174 probably benign Het
Add3 C A 19: 53,242,524 D543E probably benign Het
Angpt4 A C 2: 151,943,318 D418A probably benign Het
Ano8 A T 8: 71,483,292 V260D probably damaging Het
Cfh C T 1: 140,102,716 R860H possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Dnajb9 A T 12: 44,207,077 D182E probably benign Het
E330021D16Rik T C 6: 136,401,437 T132A probably benign Het
Epb42 G T 2: 121,030,089 probably null Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam205c A T 4: 42,874,185 probably benign Het
Fer1l6 A G 15: 58,647,149 D1710G probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Gm8369 C T 19: 11,502,232 P9S probably damaging Het
Il17ra A G 6: 120,481,511 D541G probably damaging Het
Ints4 T G 7: 97,507,733 H337Q probably damaging Het
Itgam A G 7: 128,064,732 T44A probably benign Het
Lyst C A 13: 13,740,513 T3264N probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Myo3a T A 2: 22,407,377 F728I probably damaging Het
Nacad T C 11: 6,605,534 E72G probably benign Het
Nkain3 G A 4: 20,485,003 Q25* probably null Het
Oca2 T C 7: 56,297,249 F342S probably damaging Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Osbpl6 T A 2: 76,585,229 L499Q probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Peak1 A T 9: 56,258,741 N634K probably damaging Het
Pitpnm3 T C 11: 72,051,959 K818R possibly damaging Het
Rab3gap1 T A 1: 127,925,470 probably benign Het
Rcc1l T C 5: 134,155,809 T385A probably benign Het
Rrm2 T C 12: 24,708,378 I11T probably benign Het
Scnn1b A G 7: 121,902,739 T207A possibly damaging Het
Syt12 T A 19: 4,447,681 probably benign Het
Tmprss6 A T 15: 78,446,657 probably null Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Other mutations in Vmn1r27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Vmn1r27 APN 6 58215134 missense probably benign 0.00
IGL01548:Vmn1r27 APN 6 58215553 missense probably benign 0.01
IGL02662:Vmn1r27 APN 6 58215287 missense probably damaging 1.00
IGL02726:Vmn1r27 APN 6 58215869 missense possibly damaging 0.95
IGL02795:Vmn1r27 APN 6 58215302 missense possibly damaging 0.93
IGL03241:Vmn1r27 APN 6 58215141 missense probably benign 0.04
IGL03373:Vmn1r27 APN 6 58215704 missense probably damaging 1.00
R0119:Vmn1r27 UTSW 6 58215719 missense possibly damaging 0.56
R0124:Vmn1r27 UTSW 6 58215248 missense probably damaging 1.00
R0136:Vmn1r27 UTSW 6 58215719 missense possibly damaging 0.56
R3613:Vmn1r27 UTSW 6 58215802 missense probably damaging 1.00
R4556:Vmn1r27 UTSW 6 58215819 missense possibly damaging 0.94
R4831:Vmn1r27 UTSW 6 58215842 missense possibly damaging 0.85
R5354:Vmn1r27 UTSW 6 58215596 missense probably benign 0.00
R5813:Vmn1r27 UTSW 6 58216000 missense possibly damaging 0.76
R6856:Vmn1r27 UTSW 6 58215447 missense possibly damaging 0.65
R7653:Vmn1r27 UTSW 6 58215800 missense possibly damaging 0.88
R7653:Vmn1r27 UTSW 6 58215894 missense probably benign 0.21
R8089:Vmn1r27 UTSW 6 58215209 missense possibly damaging 0.82
R8177:Vmn1r27 UTSW 6 58215774 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAACATAGAAGATCCGGCTACTAC -3'
(R):5'- GAATGTCCTTTATTTCCAAGCTGG -3'

Sequencing Primer
(F):5'- GAAGATCCGGCTACTACTGTATG -3'
(R):5'- GACTTGGAGTCCTAGCAAATATGTC -3'
Posted On2015-06-10