Incidental Mutation 'R4509:Slc44a5'
ID 331109
Institutional Source Beutler Lab
Gene Symbol Slc44a5
Ensembl Gene ENSMUSG00000028360
Gene Name solute carrier family 44, member 5
Synonyms LOC242259
MMRRC Submission 041758-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R4509 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 153973436-154271722 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 154234073 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 88 (Y88C)
Ref Sequence ENSEMBL: ENSMUSP00000087394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089948]
AlphaFold Q5RJI2
Predicted Effect probably damaging
Transcript: ENSMUST00000089948
AA Change: Y88C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087394
Gene: ENSMUSG00000028360
AA Change: Y88C

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 263 285 N/A INTRINSIC
Pfam:Choline_transpo 323 683 6.3e-114 PFAM
Meta Mutation Damage Score 0.8877 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,966,755 L657P probably damaging Het
Adam4 A T 12: 81,421,747 C33* probably null Het
Adam6b T C 12: 113,490,352 V263A probably benign Het
Arid1a A C 4: 133,695,699 probably benign Het
Ascc3 T C 10: 50,842,243 F2011L probably benign Het
Atp5j T C 16: 84,827,974 D104G probably benign Het
Cacna1d T C 14: 30,096,971 Y1209C probably damaging Het
Camta2 G A 11: 70,681,018 T484M probably benign Het
Ccdc178 T C 18: 22,067,392 N452D possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cttnbp2nl T C 3: 105,032,747 N2S probably damaging Het
Gm15032 A T X: 142,622,626 noncoding transcript Het
Gzmg G A 14: 56,156,753 P228L probably damaging Het
Hao1 T A 2: 134,523,044 D221V probably damaging Het
Ints9 A G 14: 65,028,932 D411G possibly damaging Het
Lnx1 C T 5: 74,620,192 D382N probably damaging Het
Mdn1 C T 4: 32,715,883 R2022C probably damaging Het
Mipep T C 14: 60,827,321 Y375H probably damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Pah T C 10: 87,576,215 probably null Het
Perm1 T C 4: 156,217,586 S196P probably benign Het
Pik3c2g A T 6: 139,720,006 T18S probably benign Het
Polq G A 16: 37,048,563 R765H probably damaging Het
Ppp3cb A T 14: 20,515,501 probably benign Het
Psd4 T C 2: 24,396,335 S316P probably benign Het
Ptpn18 T C 1: 34,462,742 V45A possibly damaging Het
Rasgrp3 A G 17: 75,500,673 M242V probably damaging Het
Repin1 T C 6: 48,596,526 C130R possibly damaging Het
Rrp1 G T 10: 78,412,822 T44K possibly damaging Het
Socs1 C T 16: 10,784,354 R173Q probably benign Het
Speer3 T G 5: 13,796,354 N229K possibly damaging Het
Sult2a7 T A 7: 14,470,161 I226F probably damaging Het
Tdp1 G A 12: 99,955,065 probably benign Het
Tnfrsf21 G A 17: 43,085,388 S521N probably benign Het
Tnip1 T A 11: 54,926,790 S244C probably benign Het
Ubqln3 G A 7: 104,141,444 L480F probably damaging Het
Vps13d G A 4: 145,062,602 P3817L probably damaging Het
Xpr1 A G 1: 155,290,161 probably benign Het
Zfhx3 A G 8: 108,793,779 E511G probably benign Het
Zfp560 C T 9: 20,348,723 C281Y probably damaging Het
Other mutations in Slc44a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Slc44a5 APN 3 154262939 missense probably damaging 1.00
IGL02187:Slc44a5 APN 3 154262917 missense probably benign 0.00
IGL02219:Slc44a5 APN 3 154239159 missense possibly damaging 0.76
IGL02220:Slc44a5 APN 3 154250971 missense possibly damaging 0.94
IGL02314:Slc44a5 APN 3 154256519 missense probably damaging 1.00
IGL02471:Slc44a5 APN 3 154256576 missense probably damaging 1.00
IGL02869:Slc44a5 APN 3 154251014 missense probably damaging 0.97
IGL03117:Slc44a5 APN 3 154251077 missense probably benign 0.15
IGL03144:Slc44a5 APN 3 154243540 missense possibly damaging 0.78
PIT4486001:Slc44a5 UTSW 3 154259022 missense possibly damaging 0.50
R0026:Slc44a5 UTSW 3 154240270 splice site probably benign
R0190:Slc44a5 UTSW 3 154239118 missense probably null 0.00
R0306:Slc44a5 UTSW 3 154270001 missense probably damaging 1.00
R0591:Slc44a5 UTSW 3 154234145 splice site probably benign
R0744:Slc44a5 UTSW 3 154265474 missense probably damaging 1.00
R0833:Slc44a5 UTSW 3 154265474 missense probably damaging 1.00
R0919:Slc44a5 UTSW 3 154243586 missense probably damaging 1.00
R1170:Slc44a5 UTSW 3 154257720 splice site probably null
R1370:Slc44a5 UTSW 3 154243159 missense probably benign 0.26
R1613:Slc44a5 UTSW 3 154257714 splice site probably null
R1713:Slc44a5 UTSW 3 154239106 missense probably damaging 0.97
R1999:Slc44a5 UTSW 3 154258493 missense possibly damaging 0.61
R2143:Slc44a5 UTSW 3 154258449 missense probably benign 0.01
R2293:Slc44a5 UTSW 3 154240297 missense probably benign 0.01
R2367:Slc44a5 UTSW 3 154247809 missense possibly damaging 0.94
R3842:Slc44a5 UTSW 3 154261394 splice site probably benign
R3953:Slc44a5 UTSW 3 154171572 missense probably benign 0.03
R4163:Slc44a5 UTSW 3 154261373 missense possibly damaging 0.94
R4657:Slc44a5 UTSW 3 154256584 missense possibly damaging 0.81
R4936:Slc44a5 UTSW 3 154253716 missense probably damaging 1.00
R4937:Slc44a5 UTSW 3 154243615 critical splice donor site probably null
R5083:Slc44a5 UTSW 3 154247787 missense probably benign 0.31
R5257:Slc44a5 UTSW 3 154243123 missense probably damaging 1.00
R5580:Slc44a5 UTSW 3 154261285 missense probably benign 0.03
R5586:Slc44a5 UTSW 3 154270165 utr 3 prime probably benign
R5856:Slc44a5 UTSW 3 154258392 missense possibly damaging 0.78
R5894:Slc44a5 UTSW 3 154256573 missense probably damaging 1.00
R6228:Slc44a5 UTSW 3 154239163 missense probably benign 0.00
R6248:Slc44a5 UTSW 3 154264041 missense possibly damaging 0.93
R6413:Slc44a5 UTSW 3 154257750 missense probably benign 0.21
R6454:Slc44a5 UTSW 3 154243159 missense probably benign 0.26
R6594:Slc44a5 UTSW 3 154259023 missense possibly damaging 0.85
R6761:Slc44a5 UTSW 3 154240077 splice site probably null
R6931:Slc44a5 UTSW 3 154258506 missense probably benign 0.03
R7027:Slc44a5 UTSW 3 154253719 missense probably benign 0.00
R7566:Slc44a5 UTSW 3 154269989 missense probably damaging 1.00
R7688:Slc44a5 UTSW 3 153973800 critical splice donor site probably null
R8011:Slc44a5 UTSW 3 154247810 missense possibly damaging 0.71
R8085:Slc44a5 UTSW 3 154222777 missense probably damaging 1.00
R8460:Slc44a5 UTSW 3 154270030 missense probably benign 0.00
R8765:Slc44a5 UTSW 3 154262924 missense probably damaging 0.99
R9154:Slc44a5 UTSW 3 154247736 missense probably benign 0.08
R9291:Slc44a5 UTSW 3 154256581 missense possibly damaging 0.82
R9328:Slc44a5 UTSW 3 154259041 missense probably benign 0.37
R9647:Slc44a5 UTSW 3 154247733 missense possibly damaging 0.89
R9666:Slc44a5 UTSW 3 154240289 missense probably benign 0.03
R9695:Slc44a5 UTSW 3 154250951 missense probably damaging 0.99
R9758:Slc44a5 UTSW 3 154253685 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGTTAGGCAATGTAAAGGCAG -3'
(R):5'- CACTGAAGTTGCCTAGTCACTG -3'

Sequencing Primer
(F):5'- CAGTGTGAGAATACGTTGCAC -3'
(R):5'- GAATGTAAATGAACATGACATGATGC -3'
Posted On 2015-07-21