Mutagenetix > Incidental Mutation

Incidental Mutation 'R0265:Umod'

34850

Institutional Source

Beutler Lab

Gene Symbol

Umod

Ensembl Gene

ENSMUSG00000030963

Gene Name

uromodulin

Synonyms

uromucoid, urehr4, Urehd1, Tamm-Horsfall glycoprotein

MMRRC Submission

038491-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.159) question?

Stock #

R0265 (G1)

Quality Score

107

Status

Validated

Chromosome

Chromosomal Location

119462711-119479282 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 119466073 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 578 (Q578K)

Ref Sequence

ENSEMBL: ENSMUSP00000146652 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033263] [ENSMUST00000209095]

AlphaFold

Q91X17

Predicted Effect

probably benign
Transcript: ENSMUST00000033263
AA Change: Q578K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000033263
Gene: ENSMUSG00000030963
AA Change: Q578K

Domain	Start	End	E-Value	Type
EGF	31	64	4.03e-1	SMART
EGF_CA	65	106	3.81e-11	SMART
EGF_CA	107	155	4.81e-8	SMART
Blast:ZP	256	325	6e-30	BLAST
ZP	335	586	2.19e-70	SMART
low complexity region	619	634	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208401

Predicted Effect

probably benign
Transcript: ENSMUST00000209095
AA Change: Q578K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.5%
3x: 97.4%
10x: 95.6%
20x: 92.0%

Validation Efficiency

99% (83/84)

MGI Phenotype

FUNCTION: This gene encodes a glycoprotein that is the most abundant protein in mammalian urine under physiological conditions. It is synthesized in the kidney as a glycosyl-phosphatidylinositol anchored protein and released into urine as a soluble form by proteolytic cleavage. It is thought to regulate water and salt balance in the thick ascending limb of Henle and to protect against urinary tract infection and calcium oxalate crystal formation. In mouse deficiency of this gene is associated with increased susceptibility to bacterial infections and formation of calcium crystals in kidneys. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous inactivation of this gene causes renal dysfunction and increased susceptibility to bladder infection, and may lead to renal calcinosis and stone formation. Homozygotes for an ENU-induced allele exhibit renal dysfunction and alterations in ureahandling, energy, bone, and lipid metabolism. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930452B06Rik	T	G	14: 8,431,667	Y655S	probably damaging	Het
9330182L06Rik	T	C	5: 9,434,681	L486P	probably damaging	Het
Abca14	A	G	7: 120,223,627	I321V	probably benign	Het
Adcy7	A	G	8: 88,324,763	D837G	probably damaging	Het
Aldh1a1	T	A	19: 20,640,076	Y457*	probably null	Het
Alox5	T	C	6: 116,420,362	Y287C	probably benign	Het
Ano8	T	C	8: 71,480,524		probably benign	Het
Ap3b1	A	G	13: 94,493,681	K815E	unknown	Het
Atp11a	A	T	8: 12,856,930		probably benign	Het
Atp6v0a1	A	T	11: 101,048,515	D702V	possibly damaging	Het
Cacna1b	T	A	2: 24,761,844	N108Y	probably damaging	Het
Ccdc57	G	C	11: 120,921,811	A39G	probably benign	Het
Cdhr1	A	T	14: 37,081,376	V581D	probably benign	Het
Cyp2b23	A	G	7: 26,672,879		probably benign	Het
D430041D05Rik	G	C	2: 104,167,950	P1836R	probably damaging	Het
Ddit4l	C	T	3: 137,624,287		probably benign	Het
Dnah8	A	T	17: 30,690,271	I1024F	probably benign	Het
Edc3	T	A	9: 57,727,338	F213I	probably damaging	Het
Edrf1	G	A	7: 133,657,045	D717N	probably damaging	Het
Efna5	G	A	17: 62,651,073	P63S	probably damaging	Het
Entpd3	A	G	9: 120,558,481	Y248C	probably damaging	Het
Flcn	G	A	11: 59,795,809	Q373*	probably null	Het
Fry	T	C	5: 150,434,776	V1908A	probably damaging	Het
Gabrg3	A	T	7: 57,381,617	Y58*	probably null	Het
Gabrp	A	T	11: 33,552,614	Y417N	probably damaging	Het
Golga2	C	A	2: 32,304,952		probably null	Het
Grip2	C	A	6: 91,773,792		probably null	Het
Gsx2	A	G	5: 75,077,068	Y227C	probably damaging	Het
Hif3a	T	C	7: 17,035,868	*665W	probably null	Het
Hist1h2aa	T	C	13: 23,934,649	V63A	probably benign	Het
Hsd3b1	C	A	3: 98,852,773	V301L	probably damaging	Het
Ifitm5	T	C	7: 140,950,008		probably benign	Het
Inpp4a	A	T	1: 37,378,986	D498V	probably damaging	Het
Itga1	A	T	13: 114,992,459	D554E	probably benign	Het
Itk	G	A	11: 46,389,458		probably benign	Het
Kdm3b	T	A	18: 34,795,663		probably benign	Het
Klhl6	A	G	16: 19,948,234	V470A	probably benign	Het
Lamb3	T	A	1: 193,320,531	W95R	probably damaging	Het
Lbhd2	T	A	12: 111,410,242	I41N	probably damaging	Het
Lrp4	A	T	2: 91,490,670	S1014C	probably damaging	Het
Ltbp2	C	T	12: 84,785,969		probably null	Het
Map3k19	A	G	1: 127,822,182	I1144T	possibly damaging	Het
Mfsd10	T	C	5: 34,635,163		probably benign	Het
Mocos	A	G	18: 24,666,276	D189G	probably benign	Het
Mvb12a	T	A	8: 71,547,010	F224L	probably damaging	Het
Myo15	A	T	11: 60,514,897		probably null	Het
Nos2	A	T	11: 78,937,602	H249L	probably damaging	Het
Notum	A	G	11: 120,658,334	M184T	probably benign	Het
Nvl	C	A	1: 181,134,830	D192Y	probably damaging	Het
Olfr1024	T	A	2: 85,904,247	N269I	probably benign	Het
Olfr1065	C	A	2: 86,445,959	V8L	probably benign	Het
Olfr1308	T	C	2: 111,960,494	Y193C	probably damaging	Het
Olfr204	A	T	16: 59,315,071	F112Y	probably damaging	Het
Olfr218	A	G	1: 173,203,917	K187R	probably benign	Het
Osgin1	A	G	8: 119,445,657	I397V	possibly damaging	Het
Otulin	A	G	15: 27,616,424	V123A	probably damaging	Het
P4ha1	A	G	10: 59,348,259	Y181C	probably damaging	Het
Pcdhgc5	A	T	18: 37,821,350	D559V	probably damaging	Het
Phf2	T	C	13: 48,828,794	N151S	unknown	Het
Plxnc1	C	A	10: 94,813,129	G1263C	probably benign	Het
Rad51ap1	A	G	6: 126,924,197	*338Q	probably null	Het
Raver1	A	G	9: 21,075,659	S676P	probably benign	Het
Rfx8	T	C	1: 39,688,577	E196G	possibly damaging	Het
Rreb1	A	T	13: 37,916,155	K187*	probably null	Het
Rxfp1	T	C	3: 79,667,654	T217A	probably benign	Het
Rxra	T	C	2: 27,752,430	L305P	probably damaging	Het
Sardh	T	C	2: 27,227,066		probably benign	Het
Skor2	A	T	18: 76,876,598	E952D	probably damaging	Het
Slc22a29	A	T	19: 8,169,970	S343T	probably benign	Het
Sorbs2	T	C	8: 45,785,337		probably benign	Het
Supt7l	C	T	5: 31,515,918	V329I	probably benign	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Tac1	T	C	6: 7,559,165		probably benign	Het
Tcn2	A	T	11: 3,922,044	V361D	probably damaging	Het
Tm2d3	G	A	7: 65,697,834	A170T	possibly damaging	Het
Tnks	G	A	8: 34,839,970	R1142*	probably null	Het
Ttll7	C	A	3: 146,944,160	Y648*	probably null	Het
Upf2	G	A	2: 6,027,204		probably benign	Het
Vmn2r92	C	T	17: 18,167,957	A408V	probably damaging	Het
Washc5	A	G	15: 59,338,960	I1013T	probably benign	Het
Wdr60	T	C	12: 116,257,406		probably benign	Het
Zfp704	C	A	3: 9,565,157	R48L	probably damaging	Het

Other mutations in Umod

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01151:Umod	APN	7	119477219	missense	possibly damaging	0.93
IGL02527:Umod	APN	7	119469467	missense	probably damaging	1.00
R1073:Umod	UTSW	7	119464741	missense	possibly damaging	0.56
R1117:Umod	UTSW	7	119477306	missense	possibly damaging	0.71
R1515:Umod	UTSW	7	119465497	missense	probably benign	0.00
R1774:Umod	UTSW	7	119477351	missense	possibly damaging	0.82
R1803:Umod	UTSW	7	119464724	missense	probably damaging	0.96
R1864:Umod	UTSW	7	119463255	missense	probably damaging	0.99
R1942:Umod	UTSW	7	119476932	missense	probably damaging	1.00
R2060:Umod	UTSW	7	119476715	missense	probably damaging	0.97
R2354:Umod	UTSW	7	119466193	missense	probably damaging	1.00
R3015:Umod	UTSW	7	119472540	missense	probably damaging	1.00
R3030:Umod	UTSW	7	119476839	missense	probably benign	0.02
R4016:Umod	UTSW	7	119476690	missense	possibly damaging	0.56
R4406:Umod	UTSW	7	119466064	missense	probably damaging	1.00
R4446:Umod	UTSW	7	119466056	splice site	probably null
R5062:Umod	UTSW	7	119472421	nonsense	probably null
R5358:Umod	UTSW	7	119472354	missense	probably damaging	1.00
R5935:Umod	UTSW	7	119471427	missense	probably damaging	1.00
R6045:Umod	UTSW	7	119476823	missense	probably benign
R6239:Umod	UTSW	7	119477297	missense	probably damaging	1.00
R7111:Umod	UTSW	7	119477146	nonsense	probably null
R7168:Umod	UTSW	7	119478326	splice site	probably benign
R7265:Umod	UTSW	7	119466073	missense	probably benign	0.00
R7273:Umod	UTSW	7	119477027	missense	probably benign	0.16
R8749:Umod	UTSW	7	119471416	missense	probably benign	0.00
R8786:Umod	UTSW	7	119477358	missense	possibly damaging	0.76
R8939:Umod	UTSW	7	119469477	missense	probably damaging	1.00
R9320:Umod	UTSW	7	119466132	missense	probably damaging	1.00
R9689:Umod	UTSW	7	119477294	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- GCTTGCAGCTTGCAAATAAGGTCAG -3'
(R):5'- CCCCATTCAGTTGTCCACGTACAG -3'

Sequencing Primer
(F):5'- GCTTCCTAAGTGTCAGGTAGACC -3'
(R):5'- TCAGTTGTCCACGTACAGAAGATAC -3'

Posted On

2013-05-09