Incidental Mutation 'R4737:Slc25a3'
ID359355
Institutional Source Beutler Lab
Gene Symbol Slc25a3
Ensembl Gene ENSMUSG00000061904
Gene Namesolute carrier family 25 (mitochondrial carrier, phosphate carrier), member 3
Synonyms5730556H19Rik, Phc
MMRRC Submission 042024-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4737 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location91116574-91124059 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91122188 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 97 (T97A)
Ref Sequence ENSEMBL: ENSMUSP00000129301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076694] [ENSMUST00000163246] [ENSMUST00000164505] [ENSMUST00000170810]
Predicted Effect probably benign
Transcript: ENSMUST00000076694
SMART Domains Protein: ENSMUSP00000075987
Gene: ENSMUSG00000061904

DomainStartEndE-ValueType
low complexity region 29 46 N/A INTRINSIC
Pfam:Mito_carr 58 147 3.9e-23 PFAM
Pfam:Mito_carr 156 243 4.8e-19 PFAM
Pfam:Mito_carr 254 338 3.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000103979
Predicted Effect possibly damaging
Transcript: ENSMUST00000163246
AA Change: T97A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129301
Gene: ENSMUSG00000061904
AA Change: T97A

DomainStartEndE-ValueType
low complexity region 29 46 N/A INTRINSIC
low complexity region 56 73 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164505
SMART Domains Protein: ENSMUSP00000132480
Gene: ENSMUSG00000061904

DomainStartEndE-ValueType
low complexity region 29 46 N/A INTRINSIC
Pfam:Mito_carr 58 147 3.9e-23 PFAM
Pfam:Mito_carr 156 243 4.8e-19 PFAM
Pfam:Mito_carr 254 338 3.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169339
Predicted Effect probably benign
Transcript: ENSMUST00000170810
SMART Domains Protein: ENSMUSP00000127098
Gene: ENSMUSG00000061904

DomainStartEndE-ValueType
low complexity region 29 46 N/A INTRINSIC
Pfam:Mito_carr 59 147 8.6e-21 PFAM
Pfam:Mito_carr 157 245 4.4e-19 PFAM
Pfam:Mito_carr 255 339 2.8e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172442
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (94/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the transport of phosphate into the mitochondrial matrix, either by proton cotransport or in exchange for hydroxyl ions. The protein contains three related segments arranged in tandem which are related to those found in other characterized members of the mitochondrial carrier family. Both the N-terminal and C-terminal regions of this protein protrude toward the cytosol. Multiple alternatively spliced transcript variants have been isolated. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik A G 1: 181,227,819 noncoding transcript Het
Acp2 A T 2: 91,210,723 R419W probably benign Het
Actr5 A G 2: 158,628,071 N207S probably damaging Het
Afap1 G A 5: 35,961,782 V254M probably benign Het
Arfgef1 A T 1: 10,189,611 M544K possibly damaging Het
Arhgap5 A T 12: 52,519,077 M944L probably benign Het
Bnip3l-ps G A 12: 18,216,772 noncoding transcript Het
Carf A G 1: 60,109,318 T58A probably benign Het
Carns1 A G 19: 4,170,928 probably benign Het
Ccp110 T A 7: 118,724,548 I670K possibly damaging Het
Cftr T A 6: 18,299,883 D1218E probably benign Het
Chrna9 A T 5: 65,967,871 T52S probably damaging Het
Chst9 T C 18: 15,452,777 Y243C probably damaging Het
Clk2 A T 3: 89,168,709 H62L probably benign Het
Cntnap2 A T 6: 45,060,317 R10W possibly damaging Het
Cpt1b C T 15: 89,421,406 D369N probably benign Het
Crhr2 G T 6: 55,091,305 H423Q probably damaging Het
D8Ertd738e T A 8: 84,249,521 I33F probably damaging Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Ddhd1 A T 14: 45,628,821 probably benign Het
Ddx27 A G 2: 167,029,299 I480V probably benign Het
Dpp9 A C 17: 56,198,970 probably null Het
Dpy19l3 A T 7: 35,703,501 M562K probably damaging Het
Dus3l T C 17: 56,767,868 L330P probably damaging Het
Efcab7 C T 4: 99,831,568 Q96* probably null Het
Egfr T C 11: 16,869,231 F254L probably damaging Het
Eml5 C T 12: 98,798,852 V1566M probably damaging Het
Entpd7 T A 19: 43,691,195 Y62* probably null Het
Erbb4 T C 1: 68,343,900 M313V probably damaging Het
Gm5528 A G 1: 72,004,552 noncoding transcript Het
H2-M9 G T 17: 36,640,739 Y281* probably null Het
Hmcn1 T G 1: 150,689,595 K2260N possibly damaging Het
Hnf4a A G 2: 163,564,219 I259V probably benign Het
Ick A G 9: 78,150,654 T162A probably damaging Het
Insm1 A T 2: 146,222,902 T213S probably benign Het
Iqca T C 1: 90,077,822 D488G probably damaging Het
Kdm5a T A 6: 120,406,015 probably benign Het
Kdm7a G C 6: 39,152,839 L468V possibly damaging Het
Lck G A 4: 129,555,984 T229I possibly damaging Het
Lig3 T C 11: 82,787,727 L265P probably damaging Het
Lipa T A 19: 34,501,634 K229* probably null Het
Lrrk1 C T 7: 66,306,873 S418N probably benign Het
Mark2 A G 19: 7,281,232 V126A probably damaging Het
Met T C 6: 17,491,541 C101R probably damaging Het
Mkln1 A T 6: 31,426,799 K85M probably damaging Het
Mst1 A G 9: 108,080,521 R15G probably benign Het
Muc6 T G 7: 141,640,159 probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Myo7b T C 18: 31,998,602 S514G probably damaging Het
Narfl A T 17: 25,781,309 H322L probably damaging Het
Nars T C 18: 64,516,427 E11G probably benign Het
Ogdh T A 11: 6,297,044 F23I probably benign Het
Olfr1121 T C 2: 87,372,321 I263T probably damaging Het
Olfr1186 C T 2: 88,526,225 S214F probably damaging Het
Olfr1238 C T 2: 89,406,486 V198I probably benign Het
Olfr1272 A G 2: 90,282,381 S65P probably damaging Het
Olfr584 C T 7: 103,085,914 A127V probably damaging Het
Olfr825 T A 10: 130,162,838 T163S probably benign Het
Olfr979 A T 9: 40,000,422 D268E probably damaging Het
Otub2 T A 12: 103,392,844 L64Q probably benign Het
Pappa2 T C 1: 158,957,012 R143G probably benign Het
Patl2 T A 2: 122,125,306 T250S probably damaging Het
Pcdhac2 C T 18: 37,145,899 T644I possibly damaging Het
Pi4kb C T 3: 95,004,338 T690I probably damaging Het
Pla2g4d T C 2: 120,266,790 Y776C probably benign Het
Plekhh2 C T 17: 84,563,959 S215L probably benign Het
Psmd2 T G 16: 20,659,815 probably benign Het
Ptpn21 T C 12: 98,708,844 E183G probably benign Het
Ptprg T A 14: 12,226,314 D527E probably damaging Het
Rhobtb1 T A 10: 69,279,497 probably null Het
Scel T A 14: 103,572,037 M271K possibly damaging Het
Senp3 A T 11: 69,678,829 C310* probably null Het
Srsf11 A T 3: 158,026,732 Y82* probably null Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tbkbp1 T C 11: 97,148,648 E145G probably damaging Het
Tln1 T C 4: 43,540,588 N1471S probably benign Het
Tnn T G 1: 160,146,089 D236A probably damaging Het
Trmt2a C T 16: 18,251,286 probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubxn10 G A 4: 138,735,948 probably benign Het
Ulk4 G A 9: 121,073,872 Q1180* probably null Het
Usp43 T A 11: 67,855,505 K1120N probably damaging Het
Uspl1 T A 5: 149,194,339 L244Q possibly damaging Het
Vmn1r32 T C 6: 66,553,645 H49R probably damaging Het
Vmn2r4 T C 3: 64,409,963 D118G probably damaging Het
Vwce A G 19: 10,650,579 I468V probably benign Het
Zbtb7c G T 18: 76,146,154 R561L probably benign Het
Zfp956 T C 6: 47,962,542 S175P probably damaging Het
Other mutations in Slc25a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01702:Slc25a3 APN 10 91118125 missense probably damaging 0.96
IGL02193:Slc25a3 APN 10 91118115 missense probably benign 0.01
R1215:Slc25a3 UTSW 10 91117308 missense possibly damaging 0.95
R5418:Slc25a3 UTSW 10 91119536 missense probably benign
R5799:Slc25a3 UTSW 10 91122041 missense probably benign
R6228:Slc25a3 UTSW 10 91122228 missense probably damaging 0.98
R6269:Slc25a3 UTSW 10 91117101 nonsense probably null
R6414:Slc25a3 UTSW 10 91122328 missense possibly damaging 0.66
R6866:Slc25a3 UTSW 10 91119705 missense probably damaging 0.99
R7404:Slc25a3 UTSW 10 91117040 missense possibly damaging 0.69
R7633:Slc25a3 UTSW 10 91118042 critical splice donor site probably null
Z1176:Slc25a3 UTSW 10 91123611 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGGAGCCAAATTCACAACTG -3'
(R):5'- TGGTGGCTAAAGCTGCATAC -3'

Sequencing Primer
(F):5'- GGAGCCAAATTCACAACTGTACTCTG -3'
(R):5'- GTGGCACAACACATACAG -3'
Posted On2015-11-11