Incidental Mutation 'R4737:Slc25a3'
ID 359355
Institutional Source Beutler Lab
Gene Symbol Slc25a3
Ensembl Gene ENSMUSG00000061904
Gene Name solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 3
Synonyms Phc, 5730556H19Rik
MMRRC Submission 042024-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4737 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 90952436-90959902 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 90958050 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 97 (T97A)
Ref Sequence ENSEMBL: ENSMUSP00000129301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076694] [ENSMUST00000163246] [ENSMUST00000164505] [ENSMUST00000170810]
AlphaFold Q8VEM8
Predicted Effect probably benign
Transcript: ENSMUST00000076694
SMART Domains Protein: ENSMUSP00000075987
Gene: ENSMUSG00000061904

DomainStartEndE-ValueType
low complexity region 29 46 N/A INTRINSIC
Pfam:Mito_carr 58 147 3.9e-23 PFAM
Pfam:Mito_carr 156 243 4.8e-19 PFAM
Pfam:Mito_carr 254 338 3.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000103979
Predicted Effect possibly damaging
Transcript: ENSMUST00000163246
AA Change: T97A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129301
Gene: ENSMUSG00000061904
AA Change: T97A

DomainStartEndE-ValueType
low complexity region 29 46 N/A INTRINSIC
low complexity region 56 73 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164505
SMART Domains Protein: ENSMUSP00000132480
Gene: ENSMUSG00000061904

DomainStartEndE-ValueType
low complexity region 29 46 N/A INTRINSIC
Pfam:Mito_carr 58 147 3.9e-23 PFAM
Pfam:Mito_carr 156 243 4.8e-19 PFAM
Pfam:Mito_carr 254 338 3.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171960
Predicted Effect probably benign
Transcript: ENSMUST00000170810
SMART Domains Protein: ENSMUSP00000127098
Gene: ENSMUSG00000061904

DomainStartEndE-ValueType
low complexity region 29 46 N/A INTRINSIC
Pfam:Mito_carr 59 147 8.6e-21 PFAM
Pfam:Mito_carr 157 245 4.4e-19 PFAM
Pfam:Mito_carr 255 339 2.8e-10 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (94/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the transport of phosphate into the mitochondrial matrix, either by proton cotransport or in exchange for hydroxyl ions. The protein contains three related segments arranged in tandem which are related to those found in other characterized members of the mitochondrial carrier family. Both the N-terminal and C-terminal regions of this protein protrude toward the cytosol. Multiple alternatively spliced transcript variants have been isolated. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik A G 1: 181,055,384 (GRCm39) noncoding transcript Het
Acp2 A T 2: 91,041,068 (GRCm39) R419W probably benign Het
Actr5 A G 2: 158,469,991 (GRCm39) N207S probably damaging Het
Afap1 G A 5: 36,119,126 (GRCm39) V254M probably benign Het
Arfgef1 A T 1: 10,259,836 (GRCm39) M544K possibly damaging Het
Arhgap5 A T 12: 52,565,860 (GRCm39) M944L probably benign Het
Bnip3l-ps G A 12: 18,266,773 (GRCm39) noncoding transcript Het
Carf A G 1: 60,148,477 (GRCm39) T58A probably benign Het
Carns1 A G 19: 4,220,927 (GRCm39) probably benign Het
Ccp110 T A 7: 118,323,771 (GRCm39) I670K possibly damaging Het
Cftr T A 6: 18,299,882 (GRCm39) D1218E probably benign Het
Chrna9 A T 5: 66,125,214 (GRCm39) T52S probably damaging Het
Chst9 T C 18: 15,585,834 (GRCm39) Y243C probably damaging Het
Ciao3 A T 17: 26,000,283 (GRCm39) H322L probably damaging Het
Cilk1 A G 9: 78,057,936 (GRCm39) T162A probably damaging Het
Clk2 A T 3: 89,076,016 (GRCm39) H62L probably benign Het
Cntnap2 A T 6: 45,037,251 (GRCm39) R10W possibly damaging Het
Cpt1b C T 15: 89,305,609 (GRCm39) D369N probably benign Het
Crhr2 G T 6: 55,068,290 (GRCm39) H423Q probably damaging Het
D8Ertd738e T A 8: 84,976,150 (GRCm39) I33F probably damaging Het
Dbt T C 3: 116,332,781 (GRCm39) I200T probably damaging Het
Ddhd1 A T 14: 45,866,278 (GRCm39) probably benign Het
Ddx27 A G 2: 166,871,219 (GRCm39) I480V probably benign Het
Dpp9 A C 17: 56,505,970 (GRCm39) probably null Het
Dpy19l3 A T 7: 35,402,926 (GRCm39) M562K probably damaging Het
Dus3l T C 17: 57,074,868 (GRCm39) L330P probably damaging Het
Efcab7 C T 4: 99,719,805 (GRCm39) Q96* probably null Het
Egfr T C 11: 16,819,231 (GRCm39) F254L probably damaging Het
Eml5 C T 12: 98,765,111 (GRCm39) V1566M probably damaging Het
Entpd7 T A 19: 43,679,634 (GRCm39) Y62* probably null Het
Erbb4 T C 1: 68,383,059 (GRCm39) M313V probably damaging Het
Gm5528 A G 1: 72,043,711 (GRCm39) noncoding transcript Het
H2-M9 G T 17: 36,951,631 (GRCm39) Y281* probably null Het
Hmcn1 T G 1: 150,565,346 (GRCm39) K2260N possibly damaging Het
Hnf4a A G 2: 163,406,139 (GRCm39) I259V probably benign Het
Insm1 A T 2: 146,064,822 (GRCm39) T213S probably benign Het
Iqca1 T C 1: 90,005,544 (GRCm39) D488G probably damaging Het
Kdm5a T A 6: 120,382,976 (GRCm39) probably benign Het
Kdm7a G C 6: 39,129,773 (GRCm39) L468V possibly damaging Het
Lck G A 4: 129,449,777 (GRCm39) T229I possibly damaging Het
Lig3 T C 11: 82,678,553 (GRCm39) L265P probably damaging Het
Lipa T A 19: 34,479,034 (GRCm39) K229* probably null Het
Lrrk1 C T 7: 65,956,621 (GRCm39) S418N probably benign Het
Mark2 A G 19: 7,258,597 (GRCm39) V126A probably damaging Het
Met T C 6: 17,491,540 (GRCm39) C101R probably damaging Het
Mkln1 A T 6: 31,403,734 (GRCm39) K85M probably damaging Het
Mst1 A G 9: 107,957,720 (GRCm39) R15G probably benign Het
Muc6 T G 7: 141,226,426 (GRCm39) probably benign Het
Muc6 G T 7: 141,218,685 (GRCm39) T1996N possibly damaging Het
Myo7b T C 18: 32,131,655 (GRCm39) S514G probably damaging Het
Nars1 T C 18: 64,649,498 (GRCm39) E11G probably benign Het
Ogdh T A 11: 6,247,044 (GRCm39) F23I probably benign Het
Or10g9 A T 9: 39,911,718 (GRCm39) D268E probably damaging Het
Or12e9 T C 2: 87,202,665 (GRCm39) I263T probably damaging Het
Or4a39 C T 2: 89,236,830 (GRCm39) V198I probably benign Het
Or4b1b A G 2: 90,112,725 (GRCm39) S65P probably damaging Het
Or4c100 C T 2: 88,356,569 (GRCm39) S214F probably damaging Het
Or52r1c C T 7: 102,735,121 (GRCm39) A127V probably damaging Het
Or9k2 T A 10: 129,998,707 (GRCm39) T163S probably benign Het
Otub2 T A 12: 103,359,103 (GRCm39) L64Q probably benign Het
Pappa2 T C 1: 158,784,582 (GRCm39) R143G probably benign Het
Patl2 T A 2: 121,955,787 (GRCm39) T250S probably damaging Het
Pcdhac2 C T 18: 37,278,952 (GRCm39) T644I possibly damaging Het
Pi4kb C T 3: 94,911,649 (GRCm39) T690I probably damaging Het
Pla2g4d T C 2: 120,097,271 (GRCm39) Y776C probably benign Het
Plekhh2 C T 17: 84,871,387 (GRCm39) S215L probably benign Het
Psmd2 T G 16: 20,478,565 (GRCm39) probably benign Het
Ptpn21 T C 12: 98,675,103 (GRCm39) E183G probably benign Het
Ptprg T A 14: 12,226,314 (GRCm38) D527E probably damaging Het
Rhobtb1 T A 10: 69,115,327 (GRCm39) probably null Het
Scel T A 14: 103,809,473 (GRCm39) M271K possibly damaging Het
Senp3 A T 11: 69,569,655 (GRCm39) C310* probably null Het
Srsf11 A T 3: 157,732,369 (GRCm39) Y82* probably null Het
Tbc1d8 G A 1: 39,441,959 (GRCm39) T211I possibly damaging Het
Tbkbp1 T C 11: 97,039,474 (GRCm39) E145G probably damaging Het
Tln1 T C 4: 43,540,588 (GRCm39) N1471S probably benign Het
Tnn T G 1: 159,973,659 (GRCm39) D236A probably damaging Het
Trmt2a C T 16: 18,069,150 (GRCm39) probably benign Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ubxn10 G A 4: 138,463,259 (GRCm39) probably benign Het
Ulk4 G A 9: 120,902,938 (GRCm39) Q1180* probably null Het
Usp43 T A 11: 67,746,331 (GRCm39) K1120N probably damaging Het
Uspl1 T A 5: 149,131,149 (GRCm39) L244Q possibly damaging Het
Vmn1r32 T C 6: 66,530,629 (GRCm39) H49R probably damaging Het
Vmn2r4 T C 3: 64,317,384 (GRCm39) D118G probably damaging Het
Vwce A G 19: 10,627,943 (GRCm39) I468V probably benign Het
Zbtb7c G T 18: 76,279,225 (GRCm39) R561L probably benign Het
Zfp956 T C 6: 47,939,476 (GRCm39) S175P probably damaging Het
Other mutations in Slc25a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01702:Slc25a3 APN 10 90,953,987 (GRCm39) missense probably damaging 0.96
IGL02193:Slc25a3 APN 10 90,953,977 (GRCm39) missense probably benign 0.01
R1215:Slc25a3 UTSW 10 90,953,170 (GRCm39) missense possibly damaging 0.95
R5418:Slc25a3 UTSW 10 90,955,398 (GRCm39) missense probably benign
R5799:Slc25a3 UTSW 10 90,957,903 (GRCm39) missense probably benign
R6228:Slc25a3 UTSW 10 90,958,090 (GRCm39) missense probably damaging 0.98
R6269:Slc25a3 UTSW 10 90,952,963 (GRCm39) nonsense probably null
R6414:Slc25a3 UTSW 10 90,958,190 (GRCm39) missense possibly damaging 0.66
R6866:Slc25a3 UTSW 10 90,955,567 (GRCm39) missense probably damaging 0.99
R7404:Slc25a3 UTSW 10 90,952,902 (GRCm39) missense possibly damaging 0.69
R7633:Slc25a3 UTSW 10 90,953,904 (GRCm39) critical splice donor site probably null
R8222:Slc25a3 UTSW 10 90,954,053 (GRCm39) missense probably damaging 1.00
R8751:Slc25a3 UTSW 10 90,952,960 (GRCm39) missense probably benign 0.06
Z1176:Slc25a3 UTSW 10 90,959,473 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGGAGCCAAATTCACAACTG -3'
(R):5'- TGGTGGCTAAAGCTGCATAC -3'

Sequencing Primer
(F):5'- GGAGCCAAATTCACAACTGTACTCTG -3'
(R):5'- GTGGCACAACACATACAG -3'
Posted On 2015-11-11