Incidental Mutation 'R4737:Arhgap5'
ID359364
Institutional Source Beutler Lab
Gene Symbol Arhgap5
Ensembl Gene ENSMUSG00000035133
Gene NameRho GTPase activating protein 5
Synonymsp190B, p190-B
MMRRC Submission 042024-MU
Accession Numbers

Genbank: NM_009706; MGI: 1332637

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4737 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location52503972-52571975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52519077 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 944 (M944L)
Ref Sequence ENSEMBL: ENSMUSP00000151809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110725] [ENSMUST00000217820] [ENSMUST00000219443]
Predicted Effect probably benign
Transcript: ENSMUST00000110725
AA Change: M944L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106353
Gene: ENSMUSG00000035133
AA Change: M944L

DomainStartEndE-ValueType
Pfam:Ras 142 248 5.3e-7 PFAM
FF 269 325 6.03e-12 SMART
FF 367 420 4.61e-8 SMART
FF 427 482 2.22e-10 SMART
FF 483 537 3.89e-6 SMART
low complexity region 1035 1053 N/A INTRINSIC
low complexity region 1224 1247 N/A INTRINSIC
RhoGAP 1273 1447 1.03e-73 SMART
low complexity region 1479 1496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218869
Predicted Effect probably benign
Transcript: ENSMUST00000219443
AA Change: M944L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0694 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (94/94)
MGI Phenotype Strain: 2179998
Lethality: D1-D2
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPase activating protein 5 negatively regulates RHO GTPases, a family which may mediate cytoskeleton changes by stimulating the hydrolysis of bound GTP. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes die at birth, are 30% smaller, do not inflate their lungs, and show a small thymus, abnormal adipocyte differentiation and brain defects in the corpus callosum, anterior commissure and lateral ventricles. Mutant MEFs show impaired adipogenesis but undergo myogenesis in response to IGF-1. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Gene trapped(3)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik A G 1: 181,227,819 noncoding transcript Het
Acp2 A T 2: 91,210,723 R419W probably benign Het
Actr5 A G 2: 158,628,071 N207S probably damaging Het
Afap1 G A 5: 35,961,782 V254M probably benign Het
Arfgef1 A T 1: 10,189,611 M544K possibly damaging Het
Bnip3l-ps G A 12: 18,216,772 noncoding transcript Het
Carf A G 1: 60,109,318 T58A probably benign Het
Carns1 A G 19: 4,170,928 probably benign Het
Ccp110 T A 7: 118,724,548 I670K possibly damaging Het
Cftr T A 6: 18,299,883 D1218E probably benign Het
Chrna9 A T 5: 65,967,871 T52S probably damaging Het
Chst9 T C 18: 15,452,777 Y243C probably damaging Het
Clk2 A T 3: 89,168,709 H62L probably benign Het
Cntnap2 A T 6: 45,060,317 R10W possibly damaging Het
Cpt1b C T 15: 89,421,406 D369N probably benign Het
Crhr2 G T 6: 55,091,305 H423Q probably damaging Het
D8Ertd738e T A 8: 84,249,521 I33F probably damaging Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Ddhd1 A T 14: 45,628,821 probably benign Het
Ddx27 A G 2: 167,029,299 I480V probably benign Het
Dpp9 A C 17: 56,198,970 probably null Het
Dpy19l3 A T 7: 35,703,501 M562K probably damaging Het
Dus3l T C 17: 56,767,868 L330P probably damaging Het
Efcab7 C T 4: 99,831,568 Q96* probably null Het
Egfr T C 11: 16,869,231 F254L probably damaging Het
Eml5 C T 12: 98,798,852 V1566M probably damaging Het
Entpd7 T A 19: 43,691,195 Y62* probably null Het
Erbb4 T C 1: 68,343,900 M313V probably damaging Het
Gm5528 A G 1: 72,004,552 noncoding transcript Het
H2-M9 G T 17: 36,640,739 Y281* probably null Het
Hmcn1 T G 1: 150,689,595 K2260N possibly damaging Het
Hnf4a A G 2: 163,564,219 I259V probably benign Het
Ick A G 9: 78,150,654 T162A probably damaging Het
Insm1 A T 2: 146,222,902 T213S probably benign Het
Iqca T C 1: 90,077,822 D488G probably damaging Het
Kdm5a T A 6: 120,406,015 probably benign Het
Kdm7a G C 6: 39,152,839 L468V possibly damaging Het
Lck G A 4: 129,555,984 T229I possibly damaging Het
Lig3 T C 11: 82,787,727 L265P probably damaging Het
Lipa T A 19: 34,501,634 K229* probably null Het
Lrrk1 C T 7: 66,306,873 S418N probably benign Het
Mark2 A G 19: 7,281,232 V126A probably damaging Het
Met T C 6: 17,491,541 C101R probably damaging Het
Mkln1 A T 6: 31,426,799 K85M probably damaging Het
Mst1 A G 9: 108,080,521 R15G probably benign Het
Muc6 T G 7: 141,640,159 probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Myo7b T C 18: 31,998,602 S514G probably damaging Het
Narfl A T 17: 25,781,309 H322L probably damaging Het
Nars T C 18: 64,516,427 E11G probably benign Het
Ogdh T A 11: 6,297,044 F23I probably benign Het
Olfr1121 T C 2: 87,372,321 I263T probably damaging Het
Olfr1186 C T 2: 88,526,225 S214F probably damaging Het
Olfr1238 C T 2: 89,406,486 V198I probably benign Het
Olfr1272 A G 2: 90,282,381 S65P probably damaging Het
Olfr584 C T 7: 103,085,914 A127V probably damaging Het
Olfr825 T A 10: 130,162,838 T163S probably benign Het
Olfr979 A T 9: 40,000,422 D268E probably damaging Het
Otub2 T A 12: 103,392,844 L64Q probably benign Het
Pappa2 T C 1: 158,957,012 R143G probably benign Het
Patl2 T A 2: 122,125,306 T250S probably damaging Het
Pcdhac2 C T 18: 37,145,899 T644I possibly damaging Het
Pi4kb C T 3: 95,004,338 T690I probably damaging Het
Pla2g4d T C 2: 120,266,790 Y776C probably benign Het
Plekhh2 C T 17: 84,563,959 S215L probably benign Het
Psmd2 T G 16: 20,659,815 probably benign Het
Ptpn21 T C 12: 98,708,844 E183G probably benign Het
Ptprg T A 14: 12,226,314 D527E probably damaging Het
Rhobtb1 T A 10: 69,279,497 probably null Het
Scel T A 14: 103,572,037 M271K possibly damaging Het
Senp3 A T 11: 69,678,829 C310* probably null Het
Slc25a3 T C 10: 91,122,188 T97A possibly damaging Het
Srsf11 A T 3: 158,026,732 Y82* probably null Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tbkbp1 T C 11: 97,148,648 E145G probably damaging Het
Tln1 T C 4: 43,540,588 N1471S probably benign Het
Tnn T G 1: 160,146,089 D236A probably damaging Het
Trmt2a C T 16: 18,251,286 probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubxn10 G A 4: 138,735,948 probably benign Het
Ulk4 G A 9: 121,073,872 Q1180* probably null Het
Usp43 T A 11: 67,855,505 K1120N probably damaging Het
Uspl1 T A 5: 149,194,339 L244Q possibly damaging Het
Vmn1r32 T C 6: 66,553,645 H49R probably damaging Het
Vmn2r4 T C 3: 64,409,963 D118G probably damaging Het
Vwce A G 19: 10,650,579 I468V probably benign Het
Zbtb7c G T 18: 76,146,154 R561L probably benign Het
Zfp956 T C 6: 47,962,542 S175P probably damaging Het
Other mutations in Arhgap5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Arhgap5 APN 12 52517281 missense probably damaging 0.98
IGL00823:Arhgap5 APN 12 52518742 missense possibly damaging 0.84
IGL01161:Arhgap5 APN 12 52516860 missense probably damaging 1.00
IGL01360:Arhgap5 APN 12 52518240 missense probably damaging 1.00
IGL01910:Arhgap5 APN 12 52516861 missense probably benign 0.33
IGL02417:Arhgap5 APN 12 52518353 missense probably damaging 0.99
IGL02448:Arhgap5 APN 12 52562340 missense probably damaging 0.97
IGL02813:Arhgap5 APN 12 52516965 missense probably benign 0.20
IGL03398:Arhgap5 APN 12 52517311 missense probably damaging 0.99
Decline UTSW 12 52516582 nonsense probably null
Pass UTSW 12 52516507 missense possibly damaging 0.82
3-1:Arhgap5 UTSW 12 52518882 missense possibly damaging 0.54
R0039:Arhgap5 UTSW 12 52518735 nonsense probably null
R0088:Arhgap5 UTSW 12 52516548 missense probably damaging 1.00
R0104:Arhgap5 UTSW 12 52516717 missense probably damaging 1.00
R0111:Arhgap5 UTSW 12 52559960 splice site probably benign
R0356:Arhgap5 UTSW 12 52516308 missense probably damaging 1.00
R0616:Arhgap5 UTSW 12 52517065 missense possibly damaging 0.79
R0707:Arhgap5 UTSW 12 52518168 missense probably damaging 1.00
R0718:Arhgap5 UTSW 12 52516507 missense possibly damaging 0.82
R0849:Arhgap5 UTSW 12 52519623 missense probably benign 0.01
R0975:Arhgap5 UTSW 12 52517144 missense possibly damaging 0.61
R1326:Arhgap5 UTSW 12 52518370 missense possibly damaging 0.80
R1421:Arhgap5 UTSW 12 52516848 missense probably damaging 1.00
R1422:Arhgap5 UTSW 12 52519514 missense probably damaging 1.00
R1625:Arhgap5 UTSW 12 52517376 missense probably benign
R1711:Arhgap5 UTSW 12 52519345 missense probably damaging 1.00
R1970:Arhgap5 UTSW 12 52542593 missense probably damaging 1.00
R2004:Arhgap5 UTSW 12 52518034 missense probably benign 0.05
R2356:Arhgap5 UTSW 12 52519147 missense probably benign 0.00
R3792:Arhgap5 UTSW 12 52519888 missense probably benign 0.21
R3808:Arhgap5 UTSW 12 52567187 missense possibly damaging 0.72
R4458:Arhgap5 UTSW 12 52517957 missense probably benign
R4703:Arhgap5 UTSW 12 52517583 missense probably damaging 0.99
R4736:Arhgap5 UTSW 12 52519077 missense probably benign 0.00
R4740:Arhgap5 UTSW 12 52519077 missense probably benign 0.00
R4768:Arhgap5 UTSW 12 52557492 missense probably damaging 1.00
R4806:Arhgap5 UTSW 12 52518703 missense probably damaging 0.99
R4817:Arhgap5 UTSW 12 52519209 missense possibly damaging 0.71
R5586:Arhgap5 UTSW 12 52519912 missense possibly damaging 0.95
R5681:Arhgap5 UTSW 12 52519779 missense probably benign 0.21
R5683:Arhgap5 UTSW 12 52519586 missense probably benign
R5911:Arhgap5 UTSW 12 52518742 missense possibly damaging 0.84
R6448:Arhgap5 UTSW 12 52517663 missense probably benign 0.11
R6887:Arhgap5 UTSW 12 52519144 missense probably benign
R6988:Arhgap5 UTSW 12 52518125 missense possibly damaging 0.94
R7009:Arhgap5 UTSW 12 52519639 missense probably benign 0.03
R7013:Arhgap5 UTSW 12 52518326 missense probably benign 0.05
R7239:Arhgap5 UTSW 12 52517376 missense probably benign
R7310:Arhgap5 UTSW 12 52542487 critical splice acceptor site probably null
R7339:Arhgap5 UTSW 12 52517698 missense possibly damaging 0.64
R7375:Arhgap5 UTSW 12 52516582 nonsense probably null
R7421:Arhgap5 UTSW 12 52518000 missense probably benign 0.42
R7442:Arhgap5 UTSW 12 52516956 missense probably benign 0.25
R7842:Arhgap5 UTSW 12 52518697 missense possibly damaging 0.78
R7925:Arhgap5 UTSW 12 52518697 missense possibly damaging 0.78
X0018:Arhgap5 UTSW 12 52518397 missense probably damaging 1.00
Z1176:Arhgap5 UTSW 12 52518463 missense not run
Predicted Primers PCR Primer
(F):5'- ACAACTGGTGGCAGTTACTG -3'
(R):5'- TAACCTGTATCTGGAACGGTCAC -3'

Sequencing Primer
(F):5'- GCAGTTACTGACAGTCAAGCTG -3'
(R):5'- CTAGGTGTTGGAAGCAACTGTACATC -3'
Posted On2015-11-11