Incidental Mutation 'R4737:Mark2'
ID 359384
Institutional Source Beutler Lab
Gene Symbol Mark2
Ensembl Gene ENSMUSG00000024969
Gene Name MAP/microtubule affinity regulating kinase 2
Synonyms Par-1, Emk
MMRRC Submission 042024-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.928) question?
Stock # R4737 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 7252761-7319222 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 7258597 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 126 (V126A)
Ref Sequence ENSEMBL: ENSMUSP00000129490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025921] [ENSMUST00000032557] [ENSMUST00000051711] [ENSMUST00000164129] [ENSMUST00000164205] [ENSMUST00000165286] [ENSMUST00000165965] [ENSMUST00000167767] [ENSMUST00000166461] [ENSMUST00000171352] [ENSMUST00000168872] [ENSMUST00000171393]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000025921
AA Change: V531A

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000025921
Gene: ENSMUSG00000024969
AA Change: V531A

DomainStartEndE-ValueType
S_TKc 20 271 1.59e-108 SMART
UBA 292 329 7.69e-7 SMART
low complexity region 475 489 N/A INTRINSIC
low complexity region 532 545 N/A INTRINSIC
Pfam:KA1 697 743 2.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000032557
AA Change: V510A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032557
Gene: ENSMUSG00000024969
AA Change: V510A

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 685 731 5.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051711
AA Change: V564A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000108969
Gene: ENSMUSG00000024969
AA Change: V564A

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 508 522 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
Pfam:KA1 730 776 6.6e-22 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000163345
AA Change: V56A
SMART Domains Protein: ENSMUSP00000125944
Gene: ENSMUSG00000024969
AA Change: V56A

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 58 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164129
Predicted Effect probably benign
Transcript: ENSMUST00000164205
AA Change: V510A

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127827
Gene: ENSMUSG00000024969
AA Change: V510A

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 676 722 5.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165286
AA Change: V510A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126468
Gene: ENSMUSG00000024969
AA Change: V510A

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 670 716 6e-22 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000165881
AA Change: V143A
SMART Domains Protein: ENSMUSP00000126753
Gene: ENSMUSG00000024969
AA Change: V143A

DomainStartEndE-ValueType
low complexity region 88 102 N/A INTRINSIC
low complexity region 145 158 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165965
AA Change: V564A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000131684
Gene: ENSMUSG00000024969
AA Change: V564A

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 508 522 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
Pfam:KA1 732 776 7.2e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000167767
AA Change: V52A

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132482
Gene: ENSMUSG00000024969
AA Change: V52A

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
PDB:3OSE|A 220 264 1e-18 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000166461
AA Change: V101A

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000128549
Gene: ENSMUSG00000024969
AA Change: V101A

DomainStartEndE-ValueType
low complexity region 45 59 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
Pfam:KA1 261 307 1.9e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171352
AA Change: V126A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129490
Gene: ENSMUSG00000024969
AA Change: V126A

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168872
AA Change: V510A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000128560
Gene: ENSMUSG00000024969
AA Change: V510A

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 661 707 5.9e-22 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000171721
AA Change: V554A
SMART Domains Protein: ENSMUSP00000129506
Gene: ENSMUSG00000024969
AA Change: V554A

DomainStartEndE-ValueType
S_TKc 44 295 1.59e-108 SMART
UBA 316 353 7.69e-7 SMART
low complexity region 499 513 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
Pfam:KA1 732 776 7.2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168852
Predicted Effect probably benign
Transcript: ENSMUST00000171393
SMART Domains Protein: ENSMUSP00000129894
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
Pfam:Pkinase 20 193 1.2e-59 PFAM
Pfam:Pkinase_Tyr 20 193 1.2e-35 PFAM
Pfam:RIO1 30 174 3e-7 PFAM
Meta Mutation Damage Score 0.0595 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (94/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Par-1 family of serine/threonine protein kinases. The protein is an important regulator of cell polarity in epithelial and neuronal cells, and also controls the stability of microtubules through phosphorylation and inactivation of several microtubule-associating proteins. The protein localizes to cell membranes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit proportionate dwarfism with smaller pituitaries and reduced growth hormone and prolactin secretion. Mutants develop autoimmunity and fail to breed when mated to each other. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik A G 1: 181,055,384 (GRCm39) noncoding transcript Het
Acp2 A T 2: 91,041,068 (GRCm39) R419W probably benign Het
Actr5 A G 2: 158,469,991 (GRCm39) N207S probably damaging Het
Afap1 G A 5: 36,119,126 (GRCm39) V254M probably benign Het
Arfgef1 A T 1: 10,259,836 (GRCm39) M544K possibly damaging Het
Arhgap5 A T 12: 52,565,860 (GRCm39) M944L probably benign Het
Bnip3l-ps G A 12: 18,266,773 (GRCm39) noncoding transcript Het
Carf A G 1: 60,148,477 (GRCm39) T58A probably benign Het
Carns1 A G 19: 4,220,927 (GRCm39) probably benign Het
Ccp110 T A 7: 118,323,771 (GRCm39) I670K possibly damaging Het
Cftr T A 6: 18,299,882 (GRCm39) D1218E probably benign Het
Chrna9 A T 5: 66,125,214 (GRCm39) T52S probably damaging Het
Chst9 T C 18: 15,585,834 (GRCm39) Y243C probably damaging Het
Ciao3 A T 17: 26,000,283 (GRCm39) H322L probably damaging Het
Cilk1 A G 9: 78,057,936 (GRCm39) T162A probably damaging Het
Clk2 A T 3: 89,076,016 (GRCm39) H62L probably benign Het
Cntnap2 A T 6: 45,037,251 (GRCm39) R10W possibly damaging Het
Cpt1b C T 15: 89,305,609 (GRCm39) D369N probably benign Het
Crhr2 G T 6: 55,068,290 (GRCm39) H423Q probably damaging Het
D8Ertd738e T A 8: 84,976,150 (GRCm39) I33F probably damaging Het
Dbt T C 3: 116,332,781 (GRCm39) I200T probably damaging Het
Ddhd1 A T 14: 45,866,278 (GRCm39) probably benign Het
Ddx27 A G 2: 166,871,219 (GRCm39) I480V probably benign Het
Dpp9 A C 17: 56,505,970 (GRCm39) probably null Het
Dpy19l3 A T 7: 35,402,926 (GRCm39) M562K probably damaging Het
Dus3l T C 17: 57,074,868 (GRCm39) L330P probably damaging Het
Efcab7 C T 4: 99,719,805 (GRCm39) Q96* probably null Het
Egfr T C 11: 16,819,231 (GRCm39) F254L probably damaging Het
Eml5 C T 12: 98,765,111 (GRCm39) V1566M probably damaging Het
Entpd7 T A 19: 43,679,634 (GRCm39) Y62* probably null Het
Erbb4 T C 1: 68,383,059 (GRCm39) M313V probably damaging Het
Gm5528 A G 1: 72,043,711 (GRCm39) noncoding transcript Het
H2-M9 G T 17: 36,951,631 (GRCm39) Y281* probably null Het
Hmcn1 T G 1: 150,565,346 (GRCm39) K2260N possibly damaging Het
Hnf4a A G 2: 163,406,139 (GRCm39) I259V probably benign Het
Insm1 A T 2: 146,064,822 (GRCm39) T213S probably benign Het
Iqca1 T C 1: 90,005,544 (GRCm39) D488G probably damaging Het
Kdm5a T A 6: 120,382,976 (GRCm39) probably benign Het
Kdm7a G C 6: 39,129,773 (GRCm39) L468V possibly damaging Het
Lck G A 4: 129,449,777 (GRCm39) T229I possibly damaging Het
Lig3 T C 11: 82,678,553 (GRCm39) L265P probably damaging Het
Lipa T A 19: 34,479,034 (GRCm39) K229* probably null Het
Lrrk1 C T 7: 65,956,621 (GRCm39) S418N probably benign Het
Met T C 6: 17,491,540 (GRCm39) C101R probably damaging Het
Mkln1 A T 6: 31,403,734 (GRCm39) K85M probably damaging Het
Mst1 A G 9: 107,957,720 (GRCm39) R15G probably benign Het
Muc6 T G 7: 141,226,426 (GRCm39) probably benign Het
Muc6 G T 7: 141,218,685 (GRCm39) T1996N possibly damaging Het
Myo7b T C 18: 32,131,655 (GRCm39) S514G probably damaging Het
Nars1 T C 18: 64,649,498 (GRCm39) E11G probably benign Het
Ogdh T A 11: 6,247,044 (GRCm39) F23I probably benign Het
Or10g9 A T 9: 39,911,718 (GRCm39) D268E probably damaging Het
Or12e9 T C 2: 87,202,665 (GRCm39) I263T probably damaging Het
Or4a39 C T 2: 89,236,830 (GRCm39) V198I probably benign Het
Or4b1b A G 2: 90,112,725 (GRCm39) S65P probably damaging Het
Or4c100 C T 2: 88,356,569 (GRCm39) S214F probably damaging Het
Or52r1c C T 7: 102,735,121 (GRCm39) A127V probably damaging Het
Or9k2 T A 10: 129,998,707 (GRCm39) T163S probably benign Het
Otub2 T A 12: 103,359,103 (GRCm39) L64Q probably benign Het
Pappa2 T C 1: 158,784,582 (GRCm39) R143G probably benign Het
Patl2 T A 2: 121,955,787 (GRCm39) T250S probably damaging Het
Pcdhac2 C T 18: 37,278,952 (GRCm39) T644I possibly damaging Het
Pi4kb C T 3: 94,911,649 (GRCm39) T690I probably damaging Het
Pla2g4d T C 2: 120,097,271 (GRCm39) Y776C probably benign Het
Plekhh2 C T 17: 84,871,387 (GRCm39) S215L probably benign Het
Psmd2 T G 16: 20,478,565 (GRCm39) probably benign Het
Ptpn21 T C 12: 98,675,103 (GRCm39) E183G probably benign Het
Ptprg T A 14: 12,226,314 (GRCm38) D527E probably damaging Het
Rhobtb1 T A 10: 69,115,327 (GRCm39) probably null Het
Scel T A 14: 103,809,473 (GRCm39) M271K possibly damaging Het
Senp3 A T 11: 69,569,655 (GRCm39) C310* probably null Het
Slc25a3 T C 10: 90,958,050 (GRCm39) T97A possibly damaging Het
Srsf11 A T 3: 157,732,369 (GRCm39) Y82* probably null Het
Tbc1d8 G A 1: 39,441,959 (GRCm39) T211I possibly damaging Het
Tbkbp1 T C 11: 97,039,474 (GRCm39) E145G probably damaging Het
Tln1 T C 4: 43,540,588 (GRCm39) N1471S probably benign Het
Tnn T G 1: 159,973,659 (GRCm39) D236A probably damaging Het
Trmt2a C T 16: 18,069,150 (GRCm39) probably benign Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ubxn10 G A 4: 138,463,259 (GRCm39) probably benign Het
Ulk4 G A 9: 120,902,938 (GRCm39) Q1180* probably null Het
Usp43 T A 11: 67,746,331 (GRCm39) K1120N probably damaging Het
Uspl1 T A 5: 149,131,149 (GRCm39) L244Q possibly damaging Het
Vmn1r32 T C 6: 66,530,629 (GRCm39) H49R probably damaging Het
Vmn2r4 T C 3: 64,317,384 (GRCm39) D118G probably damaging Het
Vwce A G 19: 10,627,943 (GRCm39) I468V probably benign Het
Zbtb7c G T 18: 76,279,225 (GRCm39) R561L probably benign Het
Zfp956 T C 6: 47,939,476 (GRCm39) S175P probably damaging Het
Other mutations in Mark2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Mark2 APN 19 7,318,549 (GRCm39) missense possibly damaging 0.53
IGL01522:Mark2 APN 19 7,258,603 (GRCm39) missense probably benign 0.06
IGL02368:Mark2 APN 19 7,261,855 (GRCm39) missense probably damaging 1.00
IGL02836:Mark2 APN 19 7,255,405 (GRCm39) critical splice donor site probably null
IGL03233:Mark2 APN 19 7,262,091 (GRCm39) missense possibly damaging 0.89
Unprintable UTSW 19 7,263,267 (GRCm39) missense probably damaging 1.00
R0015:Mark2 UTSW 19 7,263,142 (GRCm39) nonsense probably null
R0025:Mark2 UTSW 19 7,263,287 (GRCm39) missense probably damaging 1.00
R0025:Mark2 UTSW 19 7,263,287 (GRCm39) missense probably damaging 1.00
R0035:Mark2 UTSW 19 7,262,017 (GRCm39) splice site probably benign
R0035:Mark2 UTSW 19 7,262,017 (GRCm39) splice site probably benign
R0047:Mark2 UTSW 19 7,260,942 (GRCm39) splice site probably benign
R0047:Mark2 UTSW 19 7,260,942 (GRCm39) splice site probably benign
R0335:Mark2 UTSW 19 7,259,193 (GRCm39) missense probably benign 0.27
R0627:Mark2 UTSW 19 7,259,325 (GRCm39) critical splice acceptor site probably null
R0734:Mark2 UTSW 19 7,263,346 (GRCm39) splice site probably benign
R0744:Mark2 UTSW 19 7,263,189 (GRCm39) missense probably damaging 1.00
R0836:Mark2 UTSW 19 7,263,189 (GRCm39) missense probably damaging 1.00
R1099:Mark2 UTSW 19 7,254,790 (GRCm39) missense probably benign 0.41
R1861:Mark2 UTSW 19 7,268,128 (GRCm39) missense possibly damaging 0.73
R1873:Mark2 UTSW 19 7,261,880 (GRCm39) missense probably damaging 1.00
R2160:Mark2 UTSW 19 7,260,112 (GRCm39) missense probably damaging 1.00
R2161:Mark2 UTSW 19 7,260,112 (GRCm39) missense probably damaging 1.00
R2162:Mark2 UTSW 19 7,260,112 (GRCm39) missense probably damaging 1.00
R2308:Mark2 UTSW 19 7,259,299 (GRCm39) missense probably damaging 1.00
R2844:Mark2 UTSW 19 7,264,227 (GRCm39) missense probably damaging 1.00
R2845:Mark2 UTSW 19 7,264,227 (GRCm39) missense probably damaging 1.00
R2846:Mark2 UTSW 19 7,264,227 (GRCm39) missense probably damaging 1.00
R2902:Mark2 UTSW 19 7,260,813 (GRCm39) missense probably benign 0.00
R2935:Mark2 UTSW 19 7,263,254 (GRCm39) missense probably benign 0.09
R3853:Mark2 UTSW 19 7,254,655 (GRCm39) missense probably damaging 1.00
R4377:Mark2 UTSW 19 7,268,054 (GRCm39) missense possibly damaging 0.66
R4522:Mark2 UTSW 19 7,263,313 (GRCm39) missense probably damaging 1.00
R5103:Mark2 UTSW 19 7,261,868 (GRCm39) missense probably damaging 1.00
R5154:Mark2 UTSW 19 7,260,439 (GRCm39) missense probably damaging 0.99
R5579:Mark2 UTSW 19 7,260,181 (GRCm39) missense probably damaging 1.00
R6163:Mark2 UTSW 19 7,268,126 (GRCm39) missense probably benign 0.00
R6186:Mark2 UTSW 19 7,260,567 (GRCm39) missense probably benign 0.01
R6387:Mark2 UTSW 19 7,263,267 (GRCm39) missense probably damaging 1.00
R7032:Mark2 UTSW 19 7,264,698 (GRCm39) missense probably damaging 1.00
R7949:Mark2 UTSW 19 7,262,081 (GRCm39) missense probably benign 0.12
R8792:Mark2 UTSW 19 7,258,580 (GRCm39) missense probably benign 0.00
R8825:Mark2 UTSW 19 7,318,571 (GRCm39) missense probably benign 0.00
R8854:Mark2 UTSW 19 7,258,369 (GRCm39) missense probably benign 0.01
R9374:Mark2 UTSW 19 7,263,263 (GRCm39) missense possibly damaging 0.60
R9551:Mark2 UTSW 19 7,263,263 (GRCm39) missense possibly damaging 0.60
R9552:Mark2 UTSW 19 7,263,263 (GRCm39) missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- TGCTGAAGATGCTGCCAGAG -3'
(R):5'- CTTGCATACATGGGTCCTCCTG -3'

Sequencing Primer
(F):5'- CCGGCCCTGGCTATGGC -3'
(R):5'- GCACCATCTCACTACTGTCCTCAG -3'
Posted On 2015-11-11