Incidental Mutation 'R5190:Klra1'
ID398045
Institutional Source Beutler Lab
Gene Symbol Klra1
Ensembl Gene ENSMUSG00000079853
Gene Namekiller cell lectin-like receptor, subfamily A, member 1
SynonymsLy49o<129>, Ly49A
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R5190 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location130363917-130386874 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 130375278 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 167 (C167F)
Ref Sequence ENSEMBL: ENSMUSP00000032288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032288]
Predicted Effect probably damaging
Transcript: ENSMUST00000032288
AA Change: C167F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032288
Gene: ENSMUSG00000079853
AA Change: C167F

DomainStartEndE-ValueType
Blast:CLECT 73 118 9e-8 BLAST
CLECT 139 254 4.02e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127570
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca7 T C 10: 79,999,593 probably null Het
Abca8a C T 11: 110,089,909 probably null Het
Ablim3 A G 18: 61,819,911 Y361H probably benign Het
Acan C T 7: 79,098,541 T1020I probably benign Het
Baat A G 4: 49,499,652 L218P probably damaging Het
Bcl11b C A 12: 107,989,716 C58F probably damaging Het
Cand2 G T 6: 115,789,513 A360S probably damaging Het
Cdh2 A G 18: 16,650,315 V62A possibly damaging Het
Cep44 C T 8: 56,532,796 V354I probably benign Het
Col3a1 G A 1: 45,329,084 R309Q unknown Het
Col3a1 G A 1: 45,344,807 probably benign Het
Coq5 A G 5: 115,295,780 probably null Het
Crtac1 A G 19: 42,333,908 I131T possibly damaging Het
Decr1 C T 4: 15,924,270 V217M probably damaging Het
Dnajc13 A G 9: 104,174,525 V1706A probably benign Het
Dopey1 A G 9: 86,487,304 I63M probably damaging Het
F830045P16Rik T C 2: 129,472,715 D214G probably benign Het
Fam216a T A 5: 122,367,521 probably null Het
Fdxacb1 A C 9: 50,772,087 H248P possibly damaging Het
Gnai1 A T 5: 18,291,598 V109E probably benign Het
Helz2 A T 2: 181,230,757 probably null Het
Itgam T C 7: 128,116,317 probably null Het
Kcnh1 A G 1: 192,505,528 S766G probably benign Het
Krtap9-3 T A 11: 99,597,982 T25S probably benign Het
Mapk6 T C 9: 75,388,344 Y624C probably damaging Het
Olfr1123 A G 2: 87,418,843 Y263C probably damaging Het
Olfr1158 T A 2: 87,990,763 Y217* probably null Het
Olfr1393 T C 11: 49,280,382 V78A probably damaging Het
Olfr51 T G 11: 51,007,554 I194S probably damaging Het
Olfr677 C T 7: 105,056,453 S69L probably damaging Het
P3h2 A G 16: 25,984,949 S356P possibly damaging Het
Pde12 C T 14: 26,666,377 probably null Het
Rln3 T G 8: 84,043,237 K94N probably damaging Het
Skint5 T C 4: 113,763,514 I668V unknown Het
Slitrk5 C A 14: 111,679,420 Q159K probably damaging Het
Trim3 G T 7: 105,619,509 N79K probably damaging Het
Tyw1 T A 5: 130,267,915 C101* probably null Het
Ulk2 T C 11: 61,781,711 T934A probably benign Het
Unc5b T C 10: 60,772,293 Y687C probably benign Het
Vmn1r195 C T 13: 22,278,386 R9* probably null Het
Zfc3h1 T G 10: 115,418,692 L1397R probably damaging Het
Zfp296 T C 7: 19,577,407 V9A probably benign Het
Zfp423 T A 8: 87,782,463 S397C probably damaging Het
Other mutations in Klra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Klra1 APN 6 130364274 nonsense probably null
IGL01320:Klra1 APN 6 130364261 missense probably benign 0.02
IGL01322:Klra1 APN 6 130364261 missense probably benign 0.02
IGL02149:Klra1 APN 6 130375330 missense probably damaging 1.00
IGL02666:Klra1 APN 6 130364315 missense probably damaging 1.00
IGL02895:Klra1 APN 6 130375240 missense possibly damaging 0.51
R0004:Klra1 UTSW 6 130372873 missense probably damaging 1.00
R0408:Klra1 UTSW 6 130377774 missense probably benign 0.13
R0442:Klra1 UTSW 6 130372872 missense probably damaging 1.00
R0498:Klra1 UTSW 6 130372819 critical splice donor site probably null
R0765:Klra1 UTSW 6 130379092 splice site probably benign
R1761:Klra1 UTSW 6 130372873 missense probably damaging 1.00
R1922:Klra1 UTSW 6 130372865 missense probably benign 0.01
R1987:Klra1 UTSW 6 130377779 missense probably benign
R2882:Klra1 UTSW 6 130377863 splice site probably null
R5054:Klra1 UTSW 6 130375284 missense probably damaging 0.99
R5572:Klra1 UTSW 6 130372839 missense possibly damaging 0.73
R5825:Klra1 UTSW 6 130380629 missense probably damaging 1.00
R6784:Klra1 UTSW 6 130372854 missense probably benign 0.00
Z1176:Klra1 UTSW 6 130372851 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAAACCAGTCTCTACTTTACAGTTTTG -3'
(R):5'- TCAATTTTGAGACATGAGATTTTCCT -3'

Sequencing Primer
(F):5'- CTTTACAGTTTTGTTCACATTACAGG -3'
(R):5'- GTTACAGGCAGAGGTGATA -3'
Posted On2016-07-06