Incidental Mutation 'R5266:Tead1'
ID401703
Institutional Source Beutler Lab
Gene Symbol Tead1
Ensembl Gene ENSMUSG00000055320
Gene NameTEA domain family member 1
SynonymsGtrgeo5, mTEF-1, 2610024B07Rik, TEAD-1, B230114H05Rik, TEF-1, Tcf13
MMRRC Submission 042858-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5266 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location112679318-112906807 bp(+) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) A to G at 112759466 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059768] [ENSMUST00000069256] [ENSMUST00000084705] [ENSMUST00000106638] [ENSMUST00000164363] [ENSMUST00000165036] [ENSMUST00000168981] [ENSMUST00000170352] [ENSMUST00000171197] [ENSMUST00000171373]
Predicted Effect probably benign
Transcript: ENSMUST00000059768
SMART Domains Protein: ENSMUSP00000060671
Gene: ENSMUSG00000055320

DomainStartEndE-ValueType
TEA 11 82 3.67e-52 SMART
Pfam:TEA 95 428 3e-127 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069256
SMART Domains Protein: ENSMUSP00000130459
Gene: ENSMUSG00000055320

DomainStartEndE-ValueType
TEA 11 82 3.67e-52 SMART
low complexity region 128 144 N/A INTRINSIC
PDB:3KYS|C 194 411 1e-153 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000084705
SMART Domains Protein: ENSMUSP00000081755
Gene: ENSMUSG00000055320

DomainStartEndE-ValueType
TEA 11 82 3.67e-52 SMART
low complexity region 128 144 N/A INTRINSIC
PDB:3KYS|C 194 411 1e-153 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000106638
SMART Domains Protein: ENSMUSP00000102249
Gene: ENSMUSG00000055320

DomainStartEndE-ValueType
TEA 11 82 3.67e-52 SMART
low complexity region 132 148 N/A INTRINSIC
PDB:3KYS|C 198 415 1e-153 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163593
Predicted Effect probably benign
Transcript: ENSMUST00000164363
SMART Domains Protein: ENSMUSP00000127574
Gene: ENSMUSG00000055320

DomainStartEndE-ValueType
TEA 11 82 3.67e-52 SMART
internal_repeat_1 95 119 8.98e-7 PROSPERO
low complexity region 153 169 N/A INTRINSIC
PDB:3KYS|C 219 436 1e-153 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000165036
SMART Domains Protein: ENSMUSP00000131221
Gene: ENSMUSG00000055320

DomainStartEndE-ValueType
TEA 11 82 3.67e-52 SMART
low complexity region 132 148 N/A INTRINSIC
PDB:3KYS|C 198 415 1e-153 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000167060
SMART Domains Protein: ENSMUSP00000130564
Gene: ENSMUSG00000055320

DomainStartEndE-ValueType
Pfam:TEA 1 128 1.8e-28 PFAM
low complexity region 132 148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168328
Predicted Effect probably benign
Transcript: ENSMUST00000168981
SMART Domains Protein: ENSMUSP00000133025
Gene: ENSMUSG00000055320

DomainStartEndE-ValueType
Pfam:TEA 1 386 7.1e-166 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170352
SMART Domains Protein: ENSMUSP00000129798
Gene: ENSMUSG00000055320

DomainStartEndE-ValueType
Pfam:TEA 1 382 4.5e-163 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171197
SMART Domains Protein: ENSMUSP00000128439
Gene: ENSMUSG00000055320

DomainStartEndE-ValueType
TEA 11 82 3.67e-52 SMART
low complexity region 132 148 N/A INTRINSIC
Pfam:TEA 222 349 3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172065
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitous transcriptional enhancer factor that is a member of the TEA/ATTS domain family. This protein directs the transactivation of a wide variety of genes and, in placental cells, also acts as a transcriptional repressor. Mutations in this gene cause Sveinsson's chorioretinal atrophy. Additional transcript variants have been described but their full-length natures have not been experimentally verified. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene die between embryonic day 11 and 12.5. Abnormalities were seen in heart development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T C 18: 70,458,384 N457S probably damaging Het
Asic4 G A 1: 75,450,923 G31E probably benign Het
Atp2a3 A G 11: 72,975,397 D281G probably damaging Het
Azin1 T C 15: 38,491,551 D387G probably benign Het
Bdp1 T C 13: 100,067,535 M660V probably benign Het
Catsperg2 G A 7: 29,717,066 T307M probably damaging Het
Cfap54 T G 10: 92,815,902 K3095N probably benign Het
Chl1 A G 6: 103,700,543 N706S probably damaging Het
Crym A G 7: 120,199,294 V113A probably benign Het
Cux1 A G 5: 136,312,694 S607P probably damaging Het
Cyp3a44 T C 5: 145,794,397 N198D possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Elac1 A G 18: 73,742,669 V97A probably benign Het
Erbb3 G A 10: 128,569,636 T1251M probably damaging Het
Fam198b T A 3: 79,936,603 N12K probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hydin A G 8: 110,334,784 H316R possibly damaging Het
Ikzf3 A T 11: 98,490,580 M58K probably benign Het
Lyst T C 13: 13,660,970 Y1746H probably damaging Het
Map3k11 T A 19: 5,700,594 N613K probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mrm1 A T 11: 84,819,260 L38Q possibly damaging Het
Myo7b A G 18: 31,998,734 F470L probably damaging Het
Ndst2 G A 14: 20,724,487 R834W probably damaging Het
Olfr1173 T C 2: 88,274,221 Y276C possibly damaging Het
Olfr651 A T 7: 104,553,819 Q300L probably benign Het
Opa1 T A 16: 29,618,130 I637N probably benign Het
Padi4 A G 4: 140,746,131 V665A possibly damaging Het
Pcdh1 A G 18: 38,192,199 Y897H probably damaging Het
Pkp3 A G 7: 141,083,277 D345G probably damaging Het
Pla2g4a T C 1: 149,865,167 M366V possibly damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Pon3 T C 6: 5,240,860 D34G possibly damaging Het
Ppargc1b A T 18: 61,315,805 S133T probably damaging Het
Ppp4r3b T C 11: 29,173,309 S2P possibly damaging Het
Rbm20 A G 19: 53,813,387 T109A probably damaging Het
Rexo5 C A 7: 119,844,437 H690Q probably benign Het
Scube2 C T 7: 109,809,230 G670D probably damaging Het
Sipa1l2 T C 8: 125,492,126 I157M probably damaging Het
Slbp A T 5: 33,643,866 I167N probably damaging Het
Sry C G Y: 2,662,975 Q228H unknown Het
Stk36 T C 1: 74,611,158 V283A probably benign Het
Tecpr2 G C 12: 110,915,402 W135S probably damaging Het
Tha1 A C 11: 117,869,676 S241A probably damaging Het
Ttc39a A T 4: 109,422,504 I112F probably benign Het
Vmn1r128 A T 7: 21,349,403 T11S probably benign Het
Vnn1 G A 10: 23,903,405 C404Y probably damaging Het
Wdr41 T C 13: 94,995,251 F57L probably damaging Het
Zfp975 T G 7: 42,662,230 T320P probably damaging Het
Zfp985 A T 4: 147,582,832 probably null Het
Zfpm2 T C 15: 41,099,469 S176P probably benign Het
Other mutations in Tead1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Tead1 APN 7 112839455 missense probably damaging 1.00
IGL00678:Tead1 APN 7 112841880 splice site probably null
IGL02640:Tead1 APN 7 112861456 missense probably benign 0.09
R0635:Tead1 UTSW 7 112891706 splice site probably benign
R1469:Tead1 UTSW 7 112876184 missense probably damaging 1.00
R1469:Tead1 UTSW 7 112876184 missense probably damaging 1.00
R1981:Tead1 UTSW 7 112891745 missense probably benign 0.03
R2679:Tead1 UTSW 7 112856846 missense probably damaging 1.00
R2866:Tead1 UTSW 7 112759487 missense probably damaging 0.98
R4060:Tead1 UTSW 7 112876062 splice site probably null
R4810:Tead1 UTSW 7 112841866 splice site probably null
R5253:Tead1 UTSW 7 112861545 missense probably damaging 1.00
R6316:Tead1 UTSW 7 112891839 missense probably damaging 1.00
R6479:Tead1 UTSW 7 112861465 missense probably benign 0.00
R6562:Tead1 UTSW 7 112861443 missense probably benign
R7178:Tead1 UTSW 7 112841937 missense probably benign 0.00
R7207:Tead1 UTSW 7 112842080 missense possibly damaging 0.78
R7996:Tead1 UTSW 7 112842104 critical splice donor site probably null
R8037:Tead1 UTSW 7 112759520 missense possibly damaging 0.67
R8057:Tead1 UTSW 7 112759514 missense probably benign
R8415:Tead1 UTSW 7 112856928 missense probably benign 0.00
X0028:Tead1 UTSW 7 112859116 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CAGGAATTATTGTCCACGTAACACTG -3'
(R):5'- GAGGCCCTGAAAGGAATGTTC -3'

Sequencing Primer
(F):5'- CACGTAACACTGTTGATGACCTGTG -3'
(R):5'- GAATGTTCCAGGCCACTTACC -3'
Posted On2016-07-06