Incidental Mutation 'R5266:Olfr1173'
ID401686
Institutional Source Beutler Lab
Gene Symbol Olfr1173
Ensembl Gene ENSMUSG00000075132
Gene Nameolfactory receptor 1173
SynonymsGA_x6K02T2Q125-49759783-49758845, MOR174-20_p
MMRRC Submission 042858-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5266 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88273040-88279875 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88274221 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 276 (Y276C)
Ref Sequence ENSEMBL: ENSMUSP00000149617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099830] [ENSMUST00000216887]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099830
AA Change: Y276C

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097418
Gene: ENSMUSG00000075132
AA Change: Y276C

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.6e-46 PFAM
Pfam:7tm_1 39 288 1.3e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216887
AA Change: Y276C

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T C 18: 70,458,384 N457S probably damaging Het
Asic4 G A 1: 75,450,923 G31E probably benign Het
Atp2a3 A G 11: 72,975,397 D281G probably damaging Het
Azin1 T C 15: 38,491,551 D387G probably benign Het
Bdp1 T C 13: 100,067,535 M660V probably benign Het
Catsperg2 G A 7: 29,717,066 T307M probably damaging Het
Cfap54 T G 10: 92,815,902 K3095N probably benign Het
Chl1 A G 6: 103,700,543 N706S probably damaging Het
Crym A G 7: 120,199,294 V113A probably benign Het
Cux1 A G 5: 136,312,694 S607P probably damaging Het
Cyp3a44 T C 5: 145,794,397 N198D possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Elac1 A G 18: 73,742,669 V97A probably benign Het
Erbb3 G A 10: 128,569,636 T1251M probably damaging Het
Fam198b T A 3: 79,936,603 N12K probably damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hydin A G 8: 110,334,784 H316R possibly damaging Het
Ikzf3 A T 11: 98,490,580 M58K probably benign Het
Lyst T C 13: 13,660,970 Y1746H probably damaging Het
Map3k11 T A 19: 5,700,594 N613K probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mrm1 A T 11: 84,819,260 L38Q possibly damaging Het
Myo7b A G 18: 31,998,734 F470L probably damaging Het
Ndst2 G A 14: 20,724,487 R834W probably damaging Het
Olfr651 A T 7: 104,553,819 Q300L probably benign Het
Opa1 T A 16: 29,618,130 I637N probably benign Het
Padi4 A G 4: 140,746,131 V665A possibly damaging Het
Pcdh1 A G 18: 38,192,199 Y897H probably damaging Het
Pkp3 A G 7: 141,083,277 D345G probably damaging Het
Pla2g4a T C 1: 149,865,167 M366V possibly damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Pon3 T C 6: 5,240,860 D34G possibly damaging Het
Ppargc1b A T 18: 61,315,805 S133T probably damaging Het
Ppp4r3b T C 11: 29,173,309 S2P possibly damaging Het
Rbm20 A G 19: 53,813,387 T109A probably damaging Het
Rexo5 C A 7: 119,844,437 H690Q probably benign Het
Scube2 C T 7: 109,809,230 G670D probably damaging Het
Sipa1l2 T C 8: 125,492,126 I157M probably damaging Het
Slbp A T 5: 33,643,866 I167N probably damaging Het
Sry C G Y: 2,662,975 Q228H unknown Het
Stk36 T C 1: 74,611,158 V283A probably benign Het
Tead1 A G 7: 112,759,466 probably benign Het
Tecpr2 G C 12: 110,915,402 W135S probably damaging Het
Tha1 A C 11: 117,869,676 S241A probably damaging Het
Ttc39a A T 4: 109,422,504 I112F probably benign Het
Vmn1r128 A T 7: 21,349,403 T11S probably benign Het
Vnn1 G A 10: 23,903,405 C404Y probably damaging Het
Wdr41 T C 13: 94,995,251 F57L probably damaging Het
Zfp975 T G 7: 42,662,230 T320P probably damaging Het
Zfp985 A T 4: 147,582,832 probably null Het
Zfpm2 T C 15: 41,099,469 S176P probably benign Het
Other mutations in Olfr1173
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01079:Olfr1173 APN 2 88274716 missense probably damaging 1.00
IGL01751:Olfr1173 APN 2 88274633 missense possibly damaging 0.60
IGL02009:Olfr1173 APN 2 88274712 missense probably benign 0.06
IGL02148:Olfr1173 APN 2 88274222 missense possibly damaging 0.94
IGL02833:Olfr1173 APN 2 88274432 missense probably benign
IGL03001:Olfr1173 APN 2 88274845 missense probably damaging 1.00
R0471:Olfr1173 UTSW 2 88274215 missense possibly damaging 0.95
R2136:Olfr1173 UTSW 2 88274240 missense probably damaging 0.98
R2141:Olfr1173 UTSW 2 88275010 missense probably benign 0.30
R3957:Olfr1173 UTSW 2 88275004 missense probably damaging 1.00
R4801:Olfr1173 UTSW 2 88274879 missense probably damaging 1.00
R4802:Olfr1173 UTSW 2 88274879 missense probably damaging 1.00
R5371:Olfr1173 UTSW 2 88274632 missense probably damaging 1.00
R5775:Olfr1173 UTSW 2 88274701 missense probably damaging 0.98
R7222:Olfr1173 UTSW 2 88274465 missense probably benign 0.00
R7493:Olfr1173 UTSW 2 88275101 start gained probably benign
R7503:Olfr1173 UTSW 2 88274695 missense probably damaging 1.00
R7586:Olfr1173 UTSW 2 88274450 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAATGAGCTTGAATCAGAGTACAG -3'
(R):5'- TTGTCACAATCATCAAGATGCC -3'

Sequencing Primer
(F):5'- GCTTGAATCAGAGTACAGAACATTTG -3'
(R):5'- CCTTCTAAAGGTGGACTCAGAAAAGC -3'
Posted On2016-07-06