Incidental Mutation 'R5077:Vmn1r19'
ID401932
Institutional Source Beutler Lab
Gene Symbol Vmn1r19
Ensembl Gene ENSMUSG00000115799
Gene Namevomeronasal 1 receptor 19
SynonymsV1rc27
MMRRC Submission 042666-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R5077 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location57403780-57406034 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57405041 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 193 (I193T)
Ref Sequence ENSEMBL: ENSMUSP00000087264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089830]
Predicted Effect probably benign
Transcript: ENSMUST00000089830
AA Change: I193T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000087264
Gene: ENSMUSG00000115799
AA Change: I193T

DomainStartEndE-ValueType
Pfam:V1R 28 293 6.6e-58 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 93% (51/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T G 6: 149,326,030 S191R probably benign Het
Agbl4 A T 4: 111,566,742 M322L probably benign Het
Ankrd55 A G 13: 112,355,988 K231R probably benign Het
Asap1 A C 15: 64,127,423 M534R probably damaging Het
B4galnt2 T A 11: 95,876,314 probably benign Het
Cacna1e A T 1: 154,561,729 probably null Het
Cacna1h T C 17: 25,375,250 I2311M probably benign Het
Capn2 G T 1: 182,472,573 D617E possibly damaging Het
Catsper1 A G 19: 5,335,970 D77G probably damaging Het
Cdc42bpa A T 1: 180,094,533 probably benign Het
Cdca8 T C 4: 124,926,677 K109E probably damaging Het
Dbx1 A G 7: 49,633,494 S223P probably damaging Het
Dlg4 A G 11: 70,027,026 N45S possibly damaging Het
Dlgap2 T G 8: 14,822,691 V723G probably benign Het
Efl1 C A 7: 82,658,087 Q64K probably damaging Het
Eml1 T A 12: 108,506,612 probably benign Het
Fam129a A G 1: 151,714,523 I523V probably benign Het
Fbxw16 A G 9: 109,441,049 probably null Het
Gm10800 A T 2: 98,667,034 L80M probably benign Het
Gm5346 A G 8: 43,627,163 V8A possibly damaging Het
Hist4h4 A G 6: 136,804,115 Y89H probably benign Het
Insig2 A T 1: 121,312,235 V112E probably damaging Het
Kcnip3 A G 2: 127,465,877 S123P probably damaging Het
Map3k9 T C 12: 81,734,077 probably null Het
Myo16 T C 8: 10,322,658 V119A probably damaging Het
Naa25 G A 5: 121,424,576 V474M probably benign Het
Nckap1 A T 2: 80,548,933 V219E probably damaging Het
Nrp1 G T 8: 128,500,673 probably null Het
Nsun4 A T 4: 116,048,584 D58E probably benign Het
Obscn G T 11: 59,044,057 A5249D probably damaging Het
Olfr1055 A T 2: 86,347,339 H142Q probably benign Het
Osmr A T 15: 6,844,393 Y174* probably null Het
Pi4k2a T C 19: 42,119,836 probably null Het
Pram1 C T 17: 33,644,904 Q572* probably null Het
Prdm5 C A 6: 65,779,174 T25K probably damaging Het
Psen1 T C 12: 83,724,665 Y240H probably damaging Het
Pygl C T 12: 70,201,892 G318S probably benign Het
Rbck1 A C 2: 152,318,451 M436R probably benign Het
Rmnd1 T C 10: 4,427,488 N64D possibly damaging Het
Rsph4a A G 10: 33,908,279 D299G probably damaging Het
Sema4c T C 1: 36,551,731 S480G probably benign Het
Srp68 T C 11: 116,245,812 D552G probably damaging Het
Syde2 G T 3: 146,002,009 A568S probably damaging Het
Szrd1 G T 4: 141,139,781 probably null Het
Szt2 A T 4: 118,369,616 probably null Het
Tbc1d31 A G 15: 57,955,401 E800G probably benign Het
Tmprss11d C A 5: 86,309,263 probably null Het
Usp37 A G 1: 74,441,561 V895A probably damaging Het
Vmn2r102 T C 17: 19,677,572 V283A probably benign Het
Vps13d C T 4: 145,088,241 G3180D probably damaging Het
Xirp2 A C 2: 67,514,477 D2354A probably benign Het
Zc3h14 T A 12: 98,757,206 probably null Het
Other mutations in Vmn1r19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Vmn1r19 APN 6 57405262 missense probably benign 0.03
IGL01287:Vmn1r19 APN 6 57405194 missense probably damaging 1.00
IGL01516:Vmn1r19 APN 6 57404872 missense probably benign 0.03
IGL01895:Vmn1r19 APN 6 57405260 missense probably benign 0.02
IGL02676:Vmn1r19 APN 6 57405040 missense possibly damaging 0.94
IGL03040:Vmn1r19 APN 6 57405362 missense unknown
IGL03087:Vmn1r19 APN 6 57404491 missense probably benign 0.01
PIT4802001:Vmn1r19 UTSW 6 57405052 missense probably damaging 1.00
R0319:Vmn1r19 UTSW 6 57404615 missense possibly damaging 0.93
R1368:Vmn1r19 UTSW 6 57404671 missense probably benign 0.01
R1997:Vmn1r19 UTSW 6 57405048 missense probably damaging 1.00
R2920:Vmn1r19 UTSW 6 57404924 missense probably benign 0.03
R3857:Vmn1r19 UTSW 6 57405113 missense possibly damaging 0.68
R4090:Vmn1r19 UTSW 6 57404735 missense probably damaging 1.00
R4547:Vmn1r19 UTSW 6 57404789 missense possibly damaging 0.56
R4823:Vmn1r19 UTSW 6 57405234 nonsense probably null
R4951:Vmn1r19 UTSW 6 57404942 missense probably benign 0.36
R5459:Vmn1r19 UTSW 6 57404490 nonsense probably null
R5625:Vmn1r19 UTSW 6 57405296 missense probably damaging 1.00
R5690:Vmn1r19 UTSW 6 57404795 missense probably benign 0.10
R5761:Vmn1r19 UTSW 6 57405353 missense unknown
R6124:Vmn1r19 UTSW 6 57404617 missense probably benign 0.02
R6373:Vmn1r19 UTSW 6 57405332 missense unknown
R6476:Vmn1r19 UTSW 6 57404593 missense probably damaging 0.99
R6938:Vmn1r19 UTSW 6 57405007 missense possibly damaging 0.94
R7027:Vmn1r19 UTSW 6 57404490 nonsense probably null
R7359:Vmn1r19 UTSW 6 57405095 missense probably damaging 0.99
R7568:Vmn1r19 UTSW 6 57404828 missense possibly damaging 0.69
R7893:Vmn1r19 UTSW 6 57404679 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTATCACAATCAGTCCCAG -3'
(R):5'- ATGAGATGATGAAGTCCACCC -3'

Sequencing Primer
(F):5'- AATCAGTCCCAGTACCTCTTTGTTGG -3'
(R):5'- GATGATGAAGTCCACCCAGTACATG -3'
Posted On2016-07-22