Incidental Mutation 'R5305:Wdr25'
ID404522
Institutional Source Beutler Lab
Gene Symbol Wdr25
Ensembl Gene ENSMUSG00000040877
Gene NameWD repeat domain 25
Synonyms
MMRRC Submission 042888-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R5305 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location108893631-109028452 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 109026440 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 74 (H74N)
Ref Sequence ENSEMBL: ENSMUSP00000152632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047115] [ENSMUST00000167816] [ENSMUST00000221510]
Predicted Effect probably damaging
Transcript: ENSMUST00000047115
AA Change: H426N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035553
Gene: ENSMUSG00000040877
AA Change: H426N

DomainStartEndE-ValueType
low complexity region 120 132 N/A INTRINSIC
low complexity region 180 206 N/A INTRINSIC
WD40 226 268 1.83e-7 SMART
WD40 272 311 6.73e-6 SMART
WD40 312 353 2.58e-1 SMART
Blast:WD40 356 402 7e-11 BLAST
Blast:WD40 407 445 6e-8 BLAST
WD40 451 492 9.6e-2 SMART
WD40 495 535 3e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167816
AA Change: H426N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129855
Gene: ENSMUSG00000040877
AA Change: H426N

DomainStartEndE-ValueType
low complexity region 120 132 N/A INTRINSIC
low complexity region 180 206 N/A INTRINSIC
WD40 226 268 1.83e-7 SMART
WD40 272 311 6.73e-6 SMART
WD40 312 353 2.58e-1 SMART
Blast:WD40 356 402 7e-11 BLAST
Blast:WD40 407 445 6e-8 BLAST
WD40 451 492 9.6e-2 SMART
WD40 495 535 3e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000221510
AA Change: H74N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.8021 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 82,059,219 V11M possibly damaging Het
Acot8 A G 2: 164,795,765 V179A probably benign Het
Actb A G 5: 142,904,230 I194T probably benign Het
Ap1g2 A G 14: 55,099,076 V787A probably benign Het
Areg G T 5: 91,144,449 A203S probably damaging Het
Asb13 A T 13: 3,643,479 D79V probably damaging Het
Atad2b C T 12: 4,965,855 T527I probably damaging Het
Auts2 T G 5: 131,443,794 probably benign Het
Ceacam3 T A 7: 17,151,576 S35T probably damaging Het
Crebzf T C 7: 90,444,134 probably benign Het
Cttnbp2 G T 6: 18,381,098 N1366K probably benign Het
Cubn C A 2: 13,388,939 C1417F probably damaging Het
Dot1l C T 10: 80,790,793 P162S probably benign Het
Epc1 G A 18: 6,490,690 probably benign Het
Eps8l1 A G 7: 4,477,896 S613G possibly damaging Het
Erich6 T G 3: 58,625,116 I357L probably benign Het
Foxj3 T A 4: 119,619,958 S288T possibly damaging Het
Gls2 T G 10: 128,204,709 Y326* probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm7535 T C 17: 17,911,799 probably benign Het
Gxylt2 T G 6: 100,787,218 L288R probably damaging Het
Kdm4a T C 4: 118,160,501 Y456C probably damaging Het
Mgat4c T A 10: 102,389,279 F451L possibly damaging Het
Mrpl20 G A 4: 155,803,705 R17H probably damaging Het
Mtf2 A G 5: 108,104,499 T465A possibly damaging Het
Mycbp2 A C 14: 103,346,321 L66R probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nr2e1 A T 10: 42,571,487 Y176* probably null Het
Obscn T C 11: 59,012,715 T7628A possibly damaging Het
Olfr1353 A T 10: 78,970,556 K302N possibly damaging Het
Pitx2 T G 3: 129,215,840 V129G probably damaging Het
Polr2e A G 10: 80,038,063 probably benign Het
Ppard A G 17: 28,298,858 D300G probably damaging Het
Ppp1r27 A G 11: 120,550,917 V46A probably benign Het
Prex2 T A 1: 11,107,678 V332E probably damaging Het
Prss30 T G 17: 23,972,776 Y257S probably benign Het
Ptprd T C 4: 75,982,626 E1082G probably damaging Het
Rab3c T A 13: 110,181,077 R89S probably damaging Het
Rimbp2 A G 5: 128,797,381 V389A possibly damaging Het
Rims1 T A 1: 22,596,542 R119S probably damaging Het
Sema3b T C 9: 107,603,337 H137R probably null Het
Sf3b4 G C 3: 96,173,642 A89P probably damaging Het
Sgta T A 10: 81,046,247 Q298L probably damaging Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sry T A Y: 2,662,982 D226V unknown Het
Sv2a A G 3: 96,185,458 E158G possibly damaging Het
Sytl2 A G 7: 90,381,863 probably benign Het
Thbs3 T A 3: 89,217,976 probably benign Het
Top3a A T 11: 60,762,539 N56K possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Tyk2 T C 9: 21,109,381 D918G probably damaging Het
Uqcrh A G 4: 116,067,284 probably benign Het
Vmn1r61 A G 7: 5,610,815 S167P probably damaging Het
Zfp458 T C 13: 67,256,318 N686D probably benign Het
Zfp574 T A 7: 25,081,090 H512Q probably damaging Het
Zfp976 A T 7: 42,613,478 Y312N probably benign Het
Zscan4c G A 7: 11,009,535 V354I probably benign Het
Other mutations in Wdr25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Wdr25 APN 12 109025027 missense possibly damaging 0.89
IGL02479:Wdr25 APN 12 108898601 missense probably benign
IGL02672:Wdr25 APN 12 108898081 nonsense probably null
IGL03329:Wdr25 APN 12 108898336 missense probably benign
R1061:Wdr25 UTSW 12 108992799 splice site probably null
R1402:Wdr25 UTSW 12 109026539 missense probably damaging 1.00
R1402:Wdr25 UTSW 12 109026539 missense probably damaging 1.00
R1582:Wdr25 UTSW 12 108898054 missense possibly damaging 0.94
R1764:Wdr25 UTSW 12 109026438 nonsense probably null
R1954:Wdr25 UTSW 12 108898541 missense probably damaging 0.99
R2258:Wdr25 UTSW 12 108898174 missense possibly damaging 0.94
R3770:Wdr25 UTSW 12 108898420 missense probably damaging 0.97
R3803:Wdr25 UTSW 12 108898553 missense probably damaging 1.00
R3948:Wdr25 UTSW 12 109027282 missense probably benign 0.02
R4183:Wdr25 UTSW 12 109027331 missense probably benign 0.00
R5246:Wdr25 UTSW 12 109027456 missense probably benign 0.06
R5290:Wdr25 UTSW 12 108898042 missense probably benign 0.26
R5813:Wdr25 UTSW 12 109027421 missense possibly damaging 0.47
R5942:Wdr25 UTSW 12 108898466 missense probably benign 0.00
R6386:Wdr25 UTSW 12 109025065 missense probably damaging 1.00
R7171:Wdr25 UTSW 12 109024996 missense probably damaging 0.98
R7449:Wdr25 UTSW 12 109026441 missense probably damaging 1.00
R7616:Wdr25 UTSW 12 108992893 missense possibly damaging 0.73
R7617:Wdr25 UTSW 12 108992893 missense possibly damaging 0.73
R7619:Wdr25 UTSW 12 108992893 missense possibly damaging 0.73
R7622:Wdr25 UTSW 12 108992893 missense possibly damaging 0.73
R7623:Wdr25 UTSW 12 108992893 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TTTGTTACAACAGCAGCCACCC -3'
(R):5'- TTGTCCACAGAGCCAGCAATC -3'

Sequencing Primer
(F):5'- CACCCAGCCTCCTAAGCCAAG -3'
(R):5'- TCATACACTTGGGCAGCAG -3'
Posted On2016-07-22