Mutagenetix > Incidental Mutation

Incidental Mutation 'R5352:Snx2'

423880

Institutional Source

Beutler Lab

Gene Symbol

Snx2

Ensembl Gene

ENSMUSG00000034484

Gene Name

sorting nexin 2

Synonyms

0610030A03Rik

MMRRC Submission

042931-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5352 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

53176365-53220860 bp(+) (GRCm38)

Type of Mutation

splice site (4 bp from exon)

DNA Base Change (assembly)

A to G at 53197925 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000039243 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037850]

AlphaFold

Q9CWK8

Predicted Effect

probably null
Transcript: ENSMUST00000037850

SMART Domains

Protein: ENSMUSP00000039243
Gene: ENSMUSG00000034484

Domain	Start	End	E-Value	Type
Pfam:Sorting_nexin	2	134	1.6e-29	PFAM
PX	138	265	1.4e-38	SMART
Pfam:Vps5	281	514	2.2e-90	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the sorting nexin family whose members contain the phosphoinositide-binding phox (PX) domain. The encoded protein is a component of the retromer complex which plays a role in protein sorting in the endocytic pathway. This protein may form oligomeric complexes with other family members. Alternate splicing results in multiple transcript variants of this gene. Pseudogenes associated with this gene are located on chromosomes 1 and 7. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutant mice are viable and fertile and do not exhibit any apparent abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630010A05Rik	T	G	16: 14,618,701	L206*	probably null	Het
Adgrv1	T	C	13: 81,494,657	Y3218C	probably damaging	Het
Agtpbp1	G	A	13: 59,473,746	T41M	probably damaging	Het
Akap6	A	T	12: 52,796,097	E76V	probably damaging	Het
Ank2	C	A	3: 127,498,991		probably benign	Het
Atp6ap1l	A	C	13: 90,883,756	L269R	probably damaging	Het
Blk	A	G	14: 63,375,971	S363P	probably damaging	Het
Btnl9	T	C	11: 49,178,840	N204S	probably benign	Het
Cc2d2a	G	T	5: 43,706,213	W672C	probably damaging	Het
Ccnf	A	G	17: 24,243,273		probably null	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Chst1	A	G	2: 92,613,365	T61A	possibly damaging	Het
Col6a4	G	A	9: 106,061,544	T1325I	probably damaging	Het
Col7a1	A	C	9: 108,961,411	T976P	unknown	Het
Corin	C	T	5: 72,305,033	S811N	probably benign	Het
Dnal1	T	C	12: 84,136,548	V27A	possibly damaging	Het
Dupd1	G	A	14: 21,677,023	R186W	probably benign	Het
F830045P16Rik	T	A	2: 129,472,901	H152L	probably damaging	Het
Flnc	A	G	6: 29,449,318	S1405G	possibly damaging	Het
Foxj1	T	C	11: 116,334,079	N154S	possibly damaging	Het
Gm12183	T	C	11: 48,752,162		noncoding transcript	Het
Gm27047	G	A	6: 130,631,019		noncoding transcript	Het
Grm5	A	G	7: 88,074,850	I783V	probably damaging	Het
Hk1	A	T	10: 62,304,770	S113T	probably damaging	Het
Iqca	A	T	1: 90,130,196	N260K	probably benign	Het
Iws1	A	T	18: 32,083,404	K399M	probably damaging	Het
Kdm4d	A	G	9: 14,464,358	I68T	probably damaging	Het
Man2a1	T	C	17: 64,731,246	I75T	probably damaging	Het
Med13	T	A	11: 86,301,468	I824L	possibly damaging	Het
Meioc	A	T	11: 102,675,313	E585V	probably benign	Het
Mrgpre	A	C	7: 143,781,094	F224C	probably damaging	Het
Muc5b	T	A	7: 141,864,558	F3747Y	possibly damaging	Het
Nlrp4e	T	C	7: 23,353,173	V839A	probably benign	Het
Nup210	A	T	6: 91,069,316	V545E	probably damaging	Het
Ola1	T	C	2: 73,099,330	T310A	probably damaging	Het
Pdxdc1	T	C	16: 13,840,311	N516S	probably benign	Het
Phlpp1	A	G	1: 106,172,725	D241G	probably benign	Het
Ppp1r36	T	C	12: 76,428,083	V85A	probably damaging	Het
Rasa3	A	C	8: 13,631,778	L57R	possibly damaging	Het
Rp1	T	C	1: 4,347,098	S1264G	probably benign	Het
Rprd1b	A	G	2: 158,058,736	E247G	probably damaging	Het
Sag	G	T	1: 87,812,993	V46L	probably benign	Het
Sat2	A	T	11: 69,622,315	I17F	probably damaging	Het
Slc39a6	A	T	18: 24,601,036	Y199N	probably benign	Het
Slc9a3r2	C	T	17: 24,642,255	R66H	probably damaging	Het
Thbs4	T	C	13: 92,763,590	D466G	probably damaging	Het
Tmem208	A	G	8: 105,328,431	D91G	probably damaging	Het
Tmf1	A	G	6: 97,176,809	L101P	probably damaging	Het
Tnni1	A	G	1: 135,805,592	T51A	probably benign	Het
Tor3a	T	G	1: 156,674,193	E38A	probably damaging	Het
Trim31	T	A	17: 36,899,918	D147E	possibly damaging	Het
Uhrf1bp1	G	A	17: 27,887,515	S1005N	probably benign	Het
Vmn1r48	G	T	6: 90,036,147	A232E	probably benign	Het
Vmn1r89	T	G	7: 13,219,357	F7V	probably benign	Het
Zfp160	A	G	17: 21,026,852	T555A	probably benign	Het
Zfp981	C	A	4: 146,537,005	T129K	probably benign	Het
Zfpm2	T	A	15: 40,870,542	F106I	probably benign	Het

Other mutations in Snx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00836:Snx2	APN	18	53216400	missense	possibly damaging	0.95
IGL00861:Snx2	APN	18	53210797	splice site	probably null
IGL01116:Snx2	APN	18	53194423	splice site	probably benign
IGL01642:Snx2	APN	18	53216447	missense	probably damaging	0.99
IGL02178:Snx2	APN	18	53199785	missense	possibly damaging	0.61
IGL02368:Snx2	APN	18	53189721	missense	probably benign
IGL02597:Snx2	APN	18	53210372	missense	probably benign	0.09
IGL02964:Snx2	APN	18	53194558	missense	probably benign	0.00
IGL03372:Snx2	APN	18	53216391	missense	probably damaging	1.00
blanched	UTSW	18	53194444	missense	probably damaging	0.98
bleached	UTSW	18	53197925	splice site	probably null
R0332:Snx2	UTSW	18	53212911	missense	probably benign	0.01
R0723:Snx2	UTSW	18	53210372	missense	probably benign	0.09
R0746:Snx2	UTSW	18	53197889	missense	possibly damaging	0.90
R0826:Snx2	UTSW	18	53194522	missense	probably benign	0.00
R0894:Snx2	UTSW	18	53176416	missense	probably benign
R0970:Snx2	UTSW	18	53210690	splice site	probably benign
R1897:Snx2	UTSW	18	53197878	missense	probably damaging	0.99
R2049:Snx2	UTSW	18	53194444	missense	probably damaging	0.98
R2910:Snx2	UTSW	18	53199874	missense	probably damaging	0.99
R2911:Snx2	UTSW	18	53199874	missense	probably damaging	0.99
R4460:Snx2	UTSW	18	53176444	missense	probably benign	0.31
R5225:Snx2	UTSW	18	53189712	missense	possibly damaging	0.91
R5450:Snx2	UTSW	18	53210712	missense	probably damaging	0.99
R5576:Snx2	UTSW	18	53210750	missense	probably benign	0.33
R5965:Snx2	UTSW	18	53194462	nonsense	probably null
R6063:Snx2	UTSW	18	53209625	nonsense	probably null
R6222:Snx2	UTSW	18	53199824	nonsense	probably null
R6291:Snx2	UTSW	18	53209665	critical splice donor site	probably null
R6890:Snx2	UTSW	18	53212879	missense	probably damaging	1.00
R7380:Snx2	UTSW	18	53194568	missense	probably benign
R8081:Snx2	UTSW	18	53216387	missense	probably benign	0.13
R8363:Snx2	UTSW	18	53197864	nonsense	probably null
R9451:Snx2	UTSW	18	53210343	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- TGTGGGTATAGGCCAAGCATTTA -3'
(R):5'- CATGTAAGCATTCATGCCATCAC -3'

Sequencing Primer
(F):5'- TGATCCTGGTTAGAGAGATG -3'
(R):5'- CTGAAATCCAAATGCTTGGG -3'

Posted On

2016-08-04