Incidental Mutation 'R5352:Snx2'
ID423880
Institutional Source Beutler Lab
Gene Symbol Snx2
Ensembl Gene ENSMUSG00000034484
Gene Namesorting nexin 2
Synonyms0610030A03Rik
MMRRC Submission 042931-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5352 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location53176365-53220860 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 53197925 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037850]
Predicted Effect probably null
Transcript: ENSMUST00000037850
SMART Domains Protein: ENSMUSP00000039243
Gene: ENSMUSG00000034484

DomainStartEndE-ValueType
Pfam:Sorting_nexin 2 134 1.6e-29 PFAM
PX 138 265 1.4e-38 SMART
Pfam:Vps5 281 514 2.2e-90 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the sorting nexin family whose members contain the phosphoinositide-binding phox (PX) domain. The encoded protein is a component of the retromer complex which plays a role in protein sorting in the endocytic pathway. This protein may form oligomeric complexes with other family members. Alternate splicing results in multiple transcript variants of this gene. Pseudogenes associated with this gene are located on chromosomes 1 and 7. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutant mice are viable and fertile and do not exhibit any apparent abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T G 16: 14,618,701 L206* probably null Het
Adgrv1 T C 13: 81,494,657 Y3218C probably damaging Het
Agtpbp1 G A 13: 59,473,746 T41M probably damaging Het
Akap6 A T 12: 52,796,097 E76V probably damaging Het
Ank2 C A 3: 127,498,991 probably benign Het
Atp6ap1l A C 13: 90,883,756 L269R probably damaging Het
Blk A G 14: 63,375,971 S363P probably damaging Het
Btnl9 T C 11: 49,178,840 N204S probably benign Het
Cc2d2a G T 5: 43,706,213 W672C probably damaging Het
Ccnf A G 17: 24,243,273 probably null Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Chst1 A G 2: 92,613,365 T61A possibly damaging Het
Col6a4 G A 9: 106,061,544 T1325I probably damaging Het
Col7a1 A C 9: 108,961,411 T976P unknown Het
Corin C T 5: 72,305,033 S811N probably benign Het
Dnal1 T C 12: 84,136,548 V27A possibly damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
F830045P16Rik T A 2: 129,472,901 H152L probably damaging Het
Flnc A G 6: 29,449,318 S1405G possibly damaging Het
Foxj1 T C 11: 116,334,079 N154S possibly damaging Het
Gm12183 T C 11: 48,752,162 noncoding transcript Het
Gm27047 G A 6: 130,631,019 noncoding transcript Het
Grm5 A G 7: 88,074,850 I783V probably damaging Het
Hk1 A T 10: 62,304,770 S113T probably damaging Het
Iqca A T 1: 90,130,196 N260K probably benign Het
Iws1 A T 18: 32,083,404 K399M probably damaging Het
Kdm4d A G 9: 14,464,358 I68T probably damaging Het
Man2a1 T C 17: 64,731,246 I75T probably damaging Het
Med13 T A 11: 86,301,468 I824L possibly damaging Het
Meioc A T 11: 102,675,313 E585V probably benign Het
Mrgpre A C 7: 143,781,094 F224C probably damaging Het
Muc5b T A 7: 141,864,558 F3747Y possibly damaging Het
Nlrp4e T C 7: 23,353,173 V839A probably benign Het
Nup210 A T 6: 91,069,316 V545E probably damaging Het
Ola1 T C 2: 73,099,330 T310A probably damaging Het
Pdxdc1 T C 16: 13,840,311 N516S probably benign Het
Phlpp1 A G 1: 106,172,725 D241G probably benign Het
Ppp1r36 T C 12: 76,428,083 V85A probably damaging Het
Rasa3 A C 8: 13,631,778 L57R possibly damaging Het
Rp1 T C 1: 4,347,098 S1264G probably benign Het
Rprd1b A G 2: 158,058,736 E247G probably damaging Het
Sag G T 1: 87,812,993 V46L probably benign Het
Sat2 A T 11: 69,622,315 I17F probably damaging Het
Slc39a6 A T 18: 24,601,036 Y199N probably benign Het
Slc9a3r2 C T 17: 24,642,255 R66H probably damaging Het
Thbs4 T C 13: 92,763,590 D466G probably damaging Het
Tmem208 A G 8: 105,328,431 D91G probably damaging Het
Tmf1 A G 6: 97,176,809 L101P probably damaging Het
Tnni1 A G 1: 135,805,592 T51A probably benign Het
Tor3a T G 1: 156,674,193 E38A probably damaging Het
Trim31 T A 17: 36,899,918 D147E possibly damaging Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Vmn1r48 G T 6: 90,036,147 A232E probably benign Het
Vmn1r89 T G 7: 13,219,357 F7V probably benign Het
Zfp160 A G 17: 21,026,852 T555A probably benign Het
Zfp981 C A 4: 146,537,005 T129K probably benign Het
Zfpm2 T A 15: 40,870,542 F106I probably benign Het
Other mutations in Snx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Snx2 APN 18 53216400 missense possibly damaging 0.95
IGL00861:Snx2 APN 18 53210797 splice site probably null
IGL01116:Snx2 APN 18 53194423 splice site probably benign
IGL01642:Snx2 APN 18 53216447 missense probably damaging 0.99
IGL02178:Snx2 APN 18 53199785 missense possibly damaging 0.61
IGL02368:Snx2 APN 18 53189721 missense probably benign
IGL02597:Snx2 APN 18 53210372 missense probably benign 0.09
IGL02964:Snx2 APN 18 53194558 missense probably benign 0.00
IGL03372:Snx2 APN 18 53216391 missense probably damaging 1.00
blanched UTSW 18 53194444 missense probably damaging 0.98
bleached UTSW 18 53197925 splice site probably null
R0332:Snx2 UTSW 18 53212911 missense probably benign 0.01
R0723:Snx2 UTSW 18 53210372 missense probably benign 0.09
R0746:Snx2 UTSW 18 53197889 missense possibly damaging 0.90
R0826:Snx2 UTSW 18 53194522 missense probably benign 0.00
R0894:Snx2 UTSW 18 53176416 missense probably benign
R0970:Snx2 UTSW 18 53210690 splice site probably benign
R1897:Snx2 UTSW 18 53197878 missense probably damaging 0.99
R2049:Snx2 UTSW 18 53194444 missense probably damaging 0.98
R2910:Snx2 UTSW 18 53199874 missense probably damaging 0.99
R2911:Snx2 UTSW 18 53199874 missense probably damaging 0.99
R4460:Snx2 UTSW 18 53176444 missense probably benign 0.31
R5225:Snx2 UTSW 18 53189712 missense possibly damaging 0.91
R5450:Snx2 UTSW 18 53210712 missense probably damaging 0.99
R5576:Snx2 UTSW 18 53210750 missense probably benign 0.33
R5965:Snx2 UTSW 18 53194462 nonsense probably null
R6063:Snx2 UTSW 18 53209625 nonsense probably null
R6222:Snx2 UTSW 18 53199824 nonsense probably null
R6291:Snx2 UTSW 18 53209665 critical splice donor site probably null
R6890:Snx2 UTSW 18 53212879 missense probably damaging 1.00
R7380:Snx2 UTSW 18 53194568 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGGGTATAGGCCAAGCATTTA -3'
(R):5'- CATGTAAGCATTCATGCCATCAC -3'

Sequencing Primer
(F):5'- TGATCCTGGTTAGAGAGATG -3'
(R):5'- CTGAAATCCAAATGCTTGGG -3'
Posted On2016-08-04