Incidental Mutation 'R5406:Blk'
ID426297
Institutional Source Beutler Lab
Gene Symbol Blk
Ensembl Gene ENSMUSG00000014453
Gene NameB lymphoid kinase
Synonyms
MMRRC Submission 042976-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5406 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location63372836-63417037 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 63380731 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 242 (G242V)
Ref Sequence ENSEMBL: ENSMUSP00000014597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014597]
PDB Structure
NMR ENSEMBLE OF BLK SH2 DOMAIN, 20 STRUCTURES [SOLUTION NMR]
NMR ENSEMBLE OF BLK SH2 DOMAIN USING CHEMICAL SHIFT REFINEMENT, 20 STRUCTURES [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000014597
AA Change: G242V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014597
Gene: ENSMUSG00000014453
AA Change: G242V

DomainStartEndE-ValueType
SH3 55 111 2.91e-18 SMART
SH2 116 205 1.32e-32 SMART
TyrKc 235 484 1.97e-127 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224965
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nonreceptor tyrosine-kinase of the src family of proto-oncogenes that are typically involved in cell proliferation and differentiation. The protein has a role in B-cell receptor signaling and B-cell development. The protein also stimulates insulin synthesis and secretion in response to glucose and enhances the expression of several pancreatic beta-cell transcription factors. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygous mutation of this gene does not result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,387 V17D probably damaging Het
Abcb1a C A 5: 8,702,946 Q566K probably damaging Het
Adam26a A T 8: 43,569,104 C450S probably damaging Het
Adar C T 3: 89,736,111 P433L probably damaging Het
Aldh1a2 G T 9: 71,255,121 A151S possibly damaging Het
Arsk T A 13: 76,093,947 H69L probably benign Het
Atf6b T A 17: 34,653,797 Y600* probably null Het
Bmt2 A T 6: 13,677,832 M1K probably null Het
Catsperg1 G A 7: 29,185,523 T891M probably damaging Het
Ccdc32 A C 2: 119,022,079 S131A possibly damaging Het
Cdh8 A G 8: 99,196,370 V298A probably damaging Het
Cfap54 T A 10: 93,001,858 Q1060L probably benign Het
Cfap58 G A 19: 48,029,102 M800I possibly damaging Het
Cntn5 A T 9: 9,833,460 V362D probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
G2e3 T C 12: 51,372,666 S699P probably damaging Het
Gbp4 G T 5: 105,119,521 Q511K possibly damaging Het
Gdap2 T A 3: 100,191,675 I361N probably damaging Het
Ino80c T A 18: 24,112,762 H92L probably benign Het
Lipo4 A G 19: 33,503,218 V250A probably benign Het
Llgl1 C T 11: 60,713,184 R1055W probably damaging Het
Lrriq3 T C 3: 155,129,501 probably null Het
Mmp1a A G 9: 7,467,293 E290G probably damaging Het
Ncstn A G 1: 172,072,164 V317A probably benign Het
Nfxl1 G A 5: 72,556,198 T134I possibly damaging Het
Nup155 A T 15: 8,153,638 probably null Het
Nup214 C A 2: 32,002,607 P680T probably damaging Het
Olfr805 G A 10: 129,722,930 L205F probably damaging Het
Olfr871 A G 9: 20,213,158 K270E probably benign Het
Olfr874 A G 9: 37,746,647 N171S probably benign Het
Olfr877 G A 9: 37,855,219 V134I probably benign Het
Pkd2 T C 5: 104,480,332 F424S probably damaging Het
Plb1 A G 5: 32,341,915 D1074G probably damaging Het
Ppm1l T C 3: 69,317,594 S10P possibly damaging Het
Rnf213 A G 11: 119,440,808 H2281R probably damaging Het
Rpa2 G T 4: 132,776,248 A3S probably benign Het
Sardh A G 2: 27,211,084 V698A possibly damaging Het
Saxo2 A T 7: 82,635,378 C91S probably benign Het
Slc3a2 T C 19: 8,708,042 D198G probably damaging Het
Spata31d1d T A 13: 59,728,778 E314D probably benign Het
Sptlc3 T C 2: 139,546,478 V130A probably benign Het
Stpg3 C A 2: 25,213,568 E115* probably null Het
Tbcd T A 11: 121,452,101 D19E probably benign Het
Xrcc3 T C 12: 111,812,111 D2G probably damaging Het
Other mutations in Blk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Blk APN 14 63380720 missense probably damaging 1.00
IGL02146:Blk APN 14 63374199 missense probably damaging 1.00
IGL02684:Blk APN 14 63379694 missense probably benign 0.17
blaenka UTSW 14 63384002 missense probably damaging 1.00
R0254:Blk UTSW 14 63380804 missense probably benign 0.08
R0318:Blk UTSW 14 63374197 missense probably damaging 1.00
R1567:Blk UTSW 14 63380729 missense probably damaging 0.99
R1871:Blk UTSW 14 63375915 missense possibly damaging 0.72
R3719:Blk UTSW 14 63384002 missense probably damaging 1.00
R4606:Blk UTSW 14 63374203 missense probably benign 0.00
R4879:Blk UTSW 14 63375965 missense probably benign
R4935:Blk UTSW 14 63381262 missense possibly damaging 0.95
R5014:Blk UTSW 14 63379787 missense probably benign 0.00
R5352:Blk UTSW 14 63375971 missense probably damaging 1.00
R5514:Blk UTSW 14 63378481 missense probably damaging 0.99
R5518:Blk UTSW 14 63378507 missense possibly damaging 0.56
R6289:Blk UTSW 14 63375892 splice site probably null
R6743:Blk UTSW 14 63384926 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGTGAATCCCTTGGCATCTG -3'
(R):5'- AGGACAGTGTGGTTCTTAAGGC -3'

Sequencing Primer
(F):5'- GGCATCTGGGCTTTATAAACTC -3'
(R):5'- TTAAGGCACATCTGCTCTAGGGAC -3'
Posted On2016-09-01