Mutagenetix > Incidental Mutations

Incidental Mutation 'R5406:Llgl1'

426290

Institutional Source

Beutler Lab

Gene Symbol

Llgl1

Ensembl Gene

ENSMUSG00000020536

Gene Name

LLGL1 scribble cell polarity complex component

Synonyms

Lgl1

MMRRC Submission

042976-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5406 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

60699723-60714186 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 60713184 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 1055 (R1055W)

Ref Sequence

ENSEMBL: ENSMUSP00000060749 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002889] [ENSMUST00000052346] [ENSMUST00000108719]

Predicted Effect

probably benign
Transcript: ENSMUST00000002889

SMART Domains

Protein: ENSMUSP00000002889
Gene: ENSMUSG00000002812

Domain	Start	End	E-Value	Type
LRR	55	78	1.08e-1	SMART
LRR	103	126	4.08e0	SMART
LRR	127	149	2.27e1	SMART
LRR	150	173	1.25e-1	SMART
LRR	222	244	6.78e1	SMART
LRR	245	268	2.86e-1	SMART
LRR	269	291	3.78e-1	SMART
LRR	316	339	2.82e0	SMART
LRR	340	362	2.27e2	SMART
low complexity region	403	420	N/A	INTRINSIC
GEL	499	597	4.17e-25	SMART
GEL	617	709	1.72e-26	SMART
low complexity region	727	740	N/A	INTRINSIC
GEL	745	838	2.24e-25	SMART
GEL	905	1039	1.13e-3	SMART
GEL	1056	1152	7.28e-16	SMART
GEL	1167	1263	5.51e-25	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000052346
AA Change: R1055W

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000060749
Gene: ENSMUSG00000020536
AA Change: R1055W

Domain	Start	End	E-Value	Type
WD40	22	62	4.42e1	SMART
WD40	64	103	1.65e1	SMART
WD40	187	223	2.74e2	SMART
WD40	226	264	2.06e0	SMART
Pfam:LLGL	278	379	1.2e-43	PFAM
WD40	424	460	3.2e0	SMART
Blast:WD40	498	541	2e-13	BLAST
Blast:WD40	585	624	4e-9	BLAST
Pfam:Lgl_C	732	978	1.2e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108719

SMART Domains

Protein: ENSMUSP00000104359
Gene: ENSMUSG00000020536

Domain	Start	End	E-Value	Type
WD40	22	62	4.42e1	SMART
WD40	64	103	1.65e1	SMART
WD40	187	223	2.74e2	SMART
WD40	226	264	2.06e0	SMART
Pfam:LLGL	275	379	2e-48	PFAM
WD40	424	460	3.2e0	SMART
Blast:WD40	498	540	2e-13	BLAST
Blast:WD40	585	624	4e-9	BLAST
Pfam:Lgl_C	804	976	1.3e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154141

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to a tumor suppressor in Drosophila. The protein is part of a cytoskeletal network and is associated with nonmuscle myosin II heavy chain and a kinase that specifically phosphorylates this protein at serine residues. The gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die neonatally exhibiting hydroencephaly. Neural progenitor cell physiology is abnormal, resulting in a loss of cell polarity and the development of neuroepithelial rosette-like structures throughout the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdhppt	A	T	9: 4,309,387	V17D	probably damaging	Het
Abcb1a	C	A	5: 8,702,946	Q566K	probably damaging	Het
Adam26a	A	T	8: 43,569,104	C450S	probably damaging	Het
Adar	C	T	3: 89,736,111	P433L	probably damaging	Het
Aldh1a2	G	T	9: 71,255,121	A151S	possibly damaging	Het
Arsk	T	A	13: 76,093,947	H69L	probably benign	Het
Atf6b	T	A	17: 34,653,797	Y600*	probably null	Het
Blk	C	A	14: 63,380,731	G242V	probably damaging	Het
Bmt2	A	T	6: 13,677,832	M1K	probably null	Het
Catsperg1	G	A	7: 29,185,523	T891M	probably damaging	Het
Ccdc32	A	C	2: 119,022,079	S131A	possibly damaging	Het
Cdh8	A	G	8: 99,196,370	V298A	probably damaging	Het
Cfap54	T	A	10: 93,001,858	Q1060L	probably benign	Het
Cfap58	G	A	19: 48,029,102	M800I	possibly damaging	Het
Cntn5	A	T	9: 9,833,460	V362D	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
G2e3	T	C	12: 51,372,666	S699P	probably damaging	Het
Gbp4	G	T	5: 105,119,521	Q511K	possibly damaging	Het
Gdap2	T	A	3: 100,191,675	I361N	probably damaging	Het
Ino80c	T	A	18: 24,112,762	H92L	probably benign	Het
Lipo4	A	G	19: 33,503,218	V250A	probably benign	Het
Lrriq3	T	C	3: 155,129,501		probably null	Het
Mmp1a	A	G	9: 7,467,293	E290G	probably damaging	Het
Ncstn	A	G	1: 172,072,164	V317A	probably benign	Het
Nfxl1	G	A	5: 72,556,198	T134I	possibly damaging	Het
Nup155	A	T	15: 8,153,638		probably null	Het
Nup214	C	A	2: 32,002,607	P680T	probably damaging	Het
Olfr805	G	A	10: 129,722,930	L205F	probably damaging	Het
Olfr871	A	G	9: 20,213,158	K270E	probably benign	Het
Olfr874	A	G	9: 37,746,647	N171S	probably benign	Het
Olfr877	G	A	9: 37,855,219	V134I	probably benign	Het
Pkd2	T	C	5: 104,480,332	F424S	probably damaging	Het
Plb1	A	G	5: 32,341,915	D1074G	probably damaging	Het
Ppm1l	T	C	3: 69,317,594	S10P	possibly damaging	Het
Rnf213	A	G	11: 119,440,808	H2281R	probably damaging	Het
Rpa2	G	T	4: 132,776,248	A3S	probably benign	Het
Sardh	A	G	2: 27,211,084	V698A	possibly damaging	Het
Saxo2	A	T	7: 82,635,378	C91S	probably benign	Het
Slc3a2	T	C	19: 8,708,042	D198G	probably damaging	Het
Spata31d1d	T	A	13: 59,728,778	E314D	probably benign	Het
Sptlc3	T	C	2: 139,546,478	V130A	probably benign	Het
Stpg3	C	A	2: 25,213,568	E115*	probably null	Het
Tbcd	T	A	11: 121,452,101	D19E	probably benign	Het
Xrcc3	T	C	12: 111,812,111	D2G	probably damaging	Het

Other mutations in Llgl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01137:Llgl1	APN	11	60709999	missense	probably benign	0.38
IGL01400:Llgl1	APN	11	60706490	missense	probably damaging	1.00
IGL03066:Llgl1	APN	11	60706034	missense	possibly damaging	0.75
IGL03174:Llgl1	APN	11	60706210	missense	probably benign	0.15
IGL03306:Llgl1	APN	11	60711354	missense	possibly damaging	0.92
R0284:Llgl1	UTSW	11	60712141	missense	probably damaging	0.98
R1137:Llgl1	UTSW	11	60704733	missense	probably benign	0.01
R1432:Llgl1	UTSW	11	60708554	missense	probably damaging	1.00
R1769:Llgl1	UTSW	11	60707047	missense	probably damaging	1.00
R1786:Llgl1	UTSW	11	60707240	missense	probably benign	0.19
R1835:Llgl1	UTSW	11	60704730	missense	probably benign	0.00
R1943:Llgl1	UTSW	11	60706016	missense	probably benign
R2197:Llgl1	UTSW	11	60710039	missense	possibly damaging	0.62
R2510:Llgl1	UTSW	11	60710036	missense	probably damaging	1.00
R2568:Llgl1	UTSW	11	60708812	missense	probably damaging	1.00
R3690:Llgl1	UTSW	11	60707002	missense	probably damaging	1.00
R3853:Llgl1	UTSW	11	60707249	missense	probably damaging	1.00
R4079:Llgl1	UTSW	11	60710284	splice site	probably null
R4259:Llgl1	UTSW	11	60709568	missense	probably benign
R4348:Llgl1	UTSW	11	60709568	missense	probably benign
R4349:Llgl1	UTSW	11	60709568	missense	probably benign
R4352:Llgl1	UTSW	11	60709568	missense	probably benign
R4353:Llgl1	UTSW	11	60709568	missense	probably benign
R4396:Llgl1	UTSW	11	60706008	missense	probably benign
R4584:Llgl1	UTSW	11	60712082	missense	probably damaging	0.99
R4594:Llgl1	UTSW	11	60706321	missense	probably benign	0.15
R4628:Llgl1	UTSW	11	60709985	missense	probably damaging	1.00
R4651:Llgl1	UTSW	11	60708651	missense	possibly damaging	0.80
R4653:Llgl1	UTSW	11	60708651	missense	possibly damaging	0.80
R4731:Llgl1	UTSW	11	60706225	nonsense	probably null
R4869:Llgl1	UTSW	11	60707210	nonsense	probably null
R4898:Llgl1	UTSW	11	60709568	missense	probably benign
R4899:Llgl1	UTSW	11	60709568	missense	probably benign
R4939:Llgl1	UTSW	11	60709979	critical splice acceptor site	probably null
R4941:Llgl1	UTSW	11	60709568	missense	probably benign
R4942:Llgl1	UTSW	11	60709568	missense	probably benign
R4958:Llgl1	UTSW	11	60711435	missense	probably benign	0.02
R4995:Llgl1	UTSW	11	60709724	missense	probably benign	0.00
R4997:Llgl1	UTSW	11	60709568	missense	probably benign
R5177:Llgl1	UTSW	11	60712007	missense	possibly damaging	0.94
R5257:Llgl1	UTSW	11	60711563	splice site	probably null
R5258:Llgl1	UTSW	11	60711563	splice site	probably null
R5401:Llgl1	UTSW	11	60706471	missense	probably benign
R5432:Llgl1	UTSW	11	60707623	missense	probably benign
R5587:Llgl1	UTSW	11	60710342	missense	probably benign	0.00
R5732:Llgl1	UTSW	11	60709460	missense	probably benign	0.00
R5758:Llgl1	UTSW	11	60708567	missense	probably damaging	1.00
R5879:Llgl1	UTSW	11	60712980	missense	probably benign	0.00
R6268:Llgl1	UTSW	11	60712163	missense	probably benign	0.13
R6286:Llgl1	UTSW	11	60709532	missense	probably damaging	1.00
R6455:Llgl1	UTSW	11	60709660	missense	probably damaging	0.98
R6805:Llgl1	UTSW	11	60702865	missense	probably benign	0.25
R6929:Llgl1	UTSW	11	60710353	nonsense	probably null
R7274:Llgl1	UTSW	11	60705986	missense	possibly damaging	0.89
R7889:Llgl1	UTSW	11	60707312	missense	probably damaging	1.00
R7986:Llgl1	UTSW	11	60711395	missense	probably benign	0.16
R8141:Llgl1	UTSW	11	60710316	missense	probably benign	0.02
R8176:Llgl1	UTSW	11	60706561	missense	probably benign	0.27
R8223:Llgl1	UTSW	11	60702822	missense	possibly damaging	0.86
R8332:Llgl1	UTSW	11	60710384	missense	possibly damaging	0.90
R8350:Llgl1	UTSW	11	60712121	missense	probably damaging	1.00
R8500:Llgl1	UTSW	11	60704983	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACACAACAGGGGATGTCACC -3'
(R):5'- TAAATGCACAGGATTTCAGTGC -3'

Sequencing Primer
(F):5'- CACCGTGGAATATGTGAAGGATTTTC -3'
(R):5'- ACAGGATTTCAGTGCTGCCAG -3'

Posted On

2016-09-01