Mutagenetix > Incidental Mutations

Incidental Mutation 'R5503:Col18a1'

430746

Institutional Source

Beutler Lab

Gene Symbol

Col18a1

Ensembl Gene

ENSMUSG00000001435

Gene Name

collagen, type XVIII, alpha 1

Synonyms

endostatin

MMRRC Submission

043064-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5503 (G1)

Quality Score

214

Status

Validated

Chromosome

Chromosomal Location

77052178-77166548 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 77071620 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 861 (G861D)

Ref Sequence

ENSEMBL: ENSMUSP00000101049 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072755] [ENSMUST00000081654] [ENSMUST00000105409]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000072755
AA Change: G1108D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000072538
Gene: ENSMUSG00000001435
AA Change: G1108D

Domain	Start	End	E-Value	Type
Pfam:DUF959	16	218	6.8e-104	PFAM
low complexity region	295	307	N/A	INTRINSIC
FRI	369	484	4.03e-47	SMART
TSPN	492	680	4.25e-72	SMART
LamG	541	679	2.17e-2	SMART
low complexity region	699	715	N/A	INTRINSIC
low complexity region	719	734	N/A	INTRINSIC
low complexity region	739	751	N/A	INTRINSIC
Pfam:Collagen	820	881	5.5e-11	PFAM
low complexity region	921	942	N/A	INTRINSIC
Pfam:Collagen	951	1008	6.1e-10	PFAM
Pfam:Collagen	988	1053	1.4e-8	PFAM
Pfam:Collagen	1060	1117	7.3e-10	PFAM
low complexity region	1132	1147	N/A	INTRINSIC
low complexity region	1166	1181	N/A	INTRINSIC
low complexity region	1186	1202	N/A	INTRINSIC
Pfam:Collagen	1207	1267	8.2e-10	PFAM
low complexity region	1275	1288	N/A	INTRINSIC
low complexity region	1301	1319	N/A	INTRINSIC
low complexity region	1358	1393	N/A	INTRINSIC
low complexity region	1397	1414	N/A	INTRINSIC
low complexity region	1417	1433	N/A	INTRINSIC
low complexity region	1441	1454	N/A	INTRINSIC
Pfam:Endostatin	1461	1769	4.4e-116	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000081654
AA Change: G649D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080358
Gene: ENSMUSG00000001435
AA Change: G649D

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
TSPN	33	221	4.25e-72	SMART
LamG	82	220	2.17e-2	SMART
low complexity region	240	256	N/A	INTRINSIC
low complexity region	260	275	N/A	INTRINSIC
low complexity region	280	292	N/A	INTRINSIC
Pfam:Collagen	359	422	1.6e-10	PFAM
low complexity region	462	483	N/A	INTRINSIC
Pfam:Collagen	492	549	1.6e-9	PFAM
Pfam:Collagen	529	594	3.3e-8	PFAM
Pfam:Collagen	601	658	1.9e-9	PFAM
Pfam:Collagen	631	689	4e-8	PFAM
Pfam:Collagen	701	752	1.7e-7	PFAM
Pfam:Collagen	748	808	2.2e-9	PFAM
low complexity region	816	829	N/A	INTRINSIC
low complexity region	842	860	N/A	INTRINSIC
low complexity region	899	934	N/A	INTRINSIC
low complexity region	938	955	N/A	INTRINSIC
low complexity region	958	974	N/A	INTRINSIC
low complexity region	982	995	N/A	INTRINSIC
Pfam:Endostatin	999	1315	8.2e-151	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000105409
AA Change: G861D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101049
Gene: ENSMUSG00000001435
AA Change: G861D

Domain	Start	End	E-Value	Type
Pfam:DUF959	16	219	3.6e-100	PFAM
TSPN	245	433	4.25e-72	SMART
LamG	294	432	2.17e-2	SMART
low complexity region	452	468	N/A	INTRINSIC
low complexity region	472	487	N/A	INTRINSIC
low complexity region	492	504	N/A	INTRINSIC
low complexity region	542	613	N/A	INTRINSIC
low complexity region	630	648	N/A	INTRINSIC
low complexity region	674	695	N/A	INTRINSIC
Pfam:Collagen	700	761	5.4e-9	PFAM
Pfam:Collagen	741	806	4e-8	PFAM
Pfam:Collagen	813	874	2.1e-10	PFAM
Pfam:Collagen	846	901	1.2e-7	PFAM
Pfam:Collagen	913	964	2.1e-7	PFAM
Pfam:Collagen	960	1020	2.6e-9	PFAM
low complexity region	1028	1041	N/A	INTRINSIC
low complexity region	1054	1072	N/A	INTRINSIC
low complexity region	1111	1146	N/A	INTRINSIC
low complexity region	1150	1167	N/A	INTRINSIC
low complexity region	1170	1186	N/A	INTRINSIC
low complexity region	1194	1207	N/A	INTRINSIC
Pfam:Endostatin	1211	1527	1.1e-150	PFAM

Meta Mutation Damage Score

0.9603

Coding Region Coverage

1x: 98.3%
3x: 97.4%
10x: 95.4%
20x: 91.5%

Validation Efficiency

96% (103/107)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XVIII collagen. This collagen is one of the multiplexins, extracellular matrix proteins that contain multiple triple-helix domains (collagenous domains) interrupted by non-collagenous domains. A long isoform of the protein has an N-terminal domain that is homologous to the extracellular part of frizzled receptors. Proteolytic processing at several endogenous cleavage sites in the C-terminal domain results in production of endostatin, a potent antiangiogenic protein that is able to inhibit angiogenesis and tumor growth. Mutations in this gene are associated with Knobloch syndrome. The main features of this syndrome involve retinal abnormalities, so type XVIII collagen may play an important role in retinal structure and in neural tube closure. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in hyaloid vessel regression, attenuated visual function, abnormal electroretinograms, broad proximal tubule basement membrane, podocyte effacement, and softened glomeruli. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Abca6	A	G	11: 110,218,257	S696P	probably damaging	Het
Abca9	G	A	11: 110,141,610	T727M	probably damaging	Het
Alpk2	T	C	18: 65,306,241	R1161G	probably benign	Het
Amy1	T	C	3: 113,556,060	D487G	probably benign	Het
Arap2	G	A	5: 62,630,186	A1409V	probably damaging	Het
B020004J07Rik	A	T	4: 101,835,802	Y334N	probably benign	Het
B4galt6	C	A	18: 20,745,352		probably null	Het
Cacna1s	G	A	1: 136,086,742	G382D	probably damaging	Het
Camk2a	A	G	18: 60,978,000	D87G	probably damaging	Het
Cdh18	A	G	15: 23,436,534	Y492C	probably damaging	Het
Col4a3bp	C	T	13: 96,543,239	R26C	possibly damaging	Het
Crybg1	C	A	10: 43,998,766	S782I	probably benign	Het
Csgalnact1	G	A	8: 68,461,473	L27F	probably damaging	Het
Dab1	T	A	4: 104,512,264	C3S	probably benign	Het
Dapk1	T	C	13: 60,725,312	F343L	probably benign	Het
Dgat1	A	T	15: 76,502,194		probably benign	Het
Dnah11	C	A	12: 117,880,451		probably null	Het
Dsg2	T	A	18: 20,580,651	Y226*	probably null	Het
Epg5	T	A	18: 77,951,207	M351K	possibly damaging	Het
F13b	A	G	1: 139,522,543	T648A	probably benign	Het
Fgf17	T	C	14: 70,636,968	Y127C	probably damaging	Het
Fkbp15	G	A	4: 62,327,887	P435S	probably benign	Het
Gfm1	G	A	3: 67,453,727		probably null	Het
Gigyf1	T	C	5: 137,523,467		probably benign	Het
Gm12830	A	T	4: 114,821,739	T6S	unknown	Het
Gm6465	A	T	5: 11,848,183	N88I	probably damaging	Het
Gpr18	C	T	14: 121,911,747	V289I	probably damaging	Het
Ipp	G	T	4: 116,537,938	E557*	probably null	Het
Klhl12	T	A	1: 134,485,915		probably null	Het
Klhl38	A	G	15: 58,322,349	V328A	possibly damaging	Het
Kndc1	A	G	7: 139,931,889	T1470A	probably damaging	Het
Kntc1	T	A	5: 123,819,876	D2173E	possibly damaging	Het
Lipi	T	C	16: 75,573,976	K118E	probably benign	Het
Marf1	A	C	16: 14,152,231	L208R	probably damaging	Het
Misp	G	A	10: 79,826,718	R323K	probably damaging	Het
Mlxip	T	A	5: 123,395,327	M133K	probably damaging	Het
Mon2	A	T	10: 123,032,645	M501K	possibly damaging	Het
Myh2	A	G	11: 67,173,449	I77V	probably benign	Het
Napa	C	A	7: 16,115,624	Q254K	probably benign	Het
Nckap5l	C	A	15: 99,425,622	G1000V	probably damaging	Het
Neo1	A	T	9: 58,985,650	S236R	possibly damaging	Het
Neurl4	T	A	11: 69,906,368	Y594N	probably damaging	Het
Nmral1	G	A	16: 4,715,629	P94L	probably benign	Het
Notch3	A	T	17: 32,147,055	I1024N	probably benign	Het
Nsd1	T	A	13: 55,245,939	I451K	probably damaging	Het
Nt5c3b	T	C	11: 100,433,057	D143G	probably benign	Het
Olfr1415	C	A	1: 92,491,196	K186N	probably benign	Het
Olfr27	A	G	9: 39,144,484	N128S	probably benign	Het
Olfr316	T	A	11: 58,758,328	V221E	probably damaging	Het
Olfr45	A	C	7: 140,691,396	M164L	probably benign	Het
Olfr77	A	G	9: 19,920,379	T57A	probably benign	Het
Olfr912	T	C	9: 38,582,072	V265A	probably benign	Het
Oplah	A	G	15: 76,305,446		probably null	Het
Phb2	T	A	6: 124,713,022		probably benign	Het
Plcl2	A	G	17: 50,509,929	I108V	probably benign	Het
Plpp6	T	A	19: 28,964,746	M249K	probably damaging	Het
Pnpt1	G	A	11: 29,138,156	G189E	probably damaging	Het
Ptprn	C	T	1: 75,251,875	V853M	probably damaging	Het
Ptprq	T	C	10: 107,688,328		probably null	Het
Rai1	G	A	11: 60,186,453	V448I	probably benign	Het
Rbm20	T	A	19: 53,851,354	C925S	possibly damaging	Het
Rin3	C	A	12: 102,313,055	P41Q	probably benign	Het
Rpl31-ps21	T	C	5: 21,119,507		noncoding transcript	Het
Rpl39-ps	A	T	15: 102,635,126		noncoding transcript	Het
Rtn4ip1	T	A	10: 43,907,883	D133E	probably benign	Het
Ryr1	T	C	7: 29,069,028	K2839E	possibly damaging	Het
Sept5	T	C	16: 18,623,368	K268R	probably benign	Het
Serpinb6b	T	A	13: 32,977,659	D238E	possibly damaging	Het
Slc15a2	C	T	16: 36,762,385	V214M	probably damaging	Het
Smarca2	T	C	19: 26,623,936	M18T	probably damaging	Het
Smarca2	C	A	19: 26,682,046	T912K	possibly damaging	Het
Smdt1	A	T	15: 82,347,900	R46S	possibly damaging	Het
Spa17	A	C	9: 37,611,977	F5V	probably damaging	Het
Spag17	A	G	3: 100,027,244	E614G	possibly damaging	Het
Sstr4	CGAGGAGGAGGAGGA	CGAGGAGGAGGAGGAGGA	2: 148,395,551		probably benign	Het
Tlr1	A	T	5: 64,926,292	V314D	probably damaging	Het
Trappc8	A	T	18: 20,836,900	L1011Q	probably benign	Het
Tsga10	A	G	1: 37,760,947	*691Q	probably null	Het
Vav1	A	T	17: 57,303,079	K420*	probably null	Het
Vmn1r174	C	G	7: 23,754,137	T76R	probably benign	Het
Vmn2r116	A	G	17: 23,386,804	E230G	probably benign	Het
Vps13b	A	G	15: 35,452,166	T637A	probably damaging	Het
Zbtb7a	A	G	10: 81,144,797	E275G	probably damaging	Het
Zfp280b	A	G	10: 76,039,462		probably null	Het
Zfp763	A	G	17: 33,019,533	Y213H	possibly damaging	Het
Zfp78	T	A	7: 6,378,529	W161R	probably benign	Het

Other mutations in Col18a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Col18a1	APN	10	77069979	missense	possibly damaging	0.93
IGL01023:Col18a1	APN	10	77070975	missense	probably damaging	0.98
IGL01304:Col18a1	APN	10	77076141	unclassified	probably benign
IGL01519:Col18a1	APN	10	77059323	missense	probably damaging	0.99
IGL02217:Col18a1	APN	10	77053298	missense	probably damaging	0.96
IGL02275:Col18a1	APN	10	77059383	missense	possibly damaging	0.92
IGL02283:Col18a1	APN	10	77113109	missense	possibly damaging	0.71
IGL02492:Col18a1	APN	10	77072021	splice site	probably benign
IGL02673:Col18a1	APN	10	77059163	missense	probably damaging	1.00
IGL02710:Col18a1	APN	10	77113312	missense	possibly damaging	0.92
IGL02850:Col18a1	APN	10	77096466	missense	probably damaging	0.98
IGL03085:Col18a1	APN	10	77059181	splice site	probably benign
IGL03102:Col18a1	APN	10	77067623	splice site	probably benign
IGL03139:Col18a1	APN	10	77113343	missense	possibly damaging	0.84
IGL03181:Col18a1	APN	10	77055698	missense	probably damaging	1.00
IGL03183:Col18a1	APN	10	77073754	missense	probably damaging	1.00
R0039:Col18a1	UTSW	10	77077168	missense	probably damaging	1.00
R0180:Col18a1	UTSW	10	77096517	missense	probably benign	0.33
R0225:Col18a1	UTSW	10	77088914	missense	possibly damaging	0.90
R0335:Col18a1	UTSW	10	77059363	missense	probably damaging	0.99
R0336:Col18a1	UTSW	10	77058736	missense	probably damaging	1.00
R1471:Col18a1	UTSW	10	77096206	missense	unknown
R1538:Col18a1	UTSW	10	77071336	missense	probably damaging	1.00
R1594:Col18a1	UTSW	10	77113036	missense	possibly damaging	0.51
R1631:Col18a1	UTSW	10	77059297	missense	probably damaging	0.99
R1774:Col18a1	UTSW	10	77059981	missense	probably damaging	0.96
R1934:Col18a1	UTSW	10	77112744	missense	possibly damaging	0.73
R1990:Col18a1	UTSW	10	77081154	missense	unknown
R1991:Col18a1	UTSW	10	77081154	missense	unknown
R1992:Col18a1	UTSW	10	77081154	missense	unknown
R2081:Col18a1	UTSW	10	77054185	missense	probably damaging	1.00
R2082:Col18a1	UTSW	10	77059293	missense	probably damaging	1.00
R2351:Col18a1	UTSW	10	77112704	missense	probably benign	0.00
R2510:Col18a1	UTSW	10	77096268	missense	unknown
R3076:Col18a1	UTSW	10	77088928	missense	possibly damaging	0.57
R3433:Col18a1	UTSW	10	77096268	missense	unknown
R3800:Col18a1	UTSW	10	77067387	nonsense	probably null
R3918:Col18a1	UTSW	10	77053358	missense	probably benign	0.05
R3981:Col18a1	UTSW	10	77088887	missense	probably damaging	0.99
R3983:Col18a1	UTSW	10	77088887	missense	probably damaging	0.99
R4182:Col18a1	UTSW	10	77058841	splice site	probably null
R4239:Col18a1	UTSW	10	77096167	missense	unknown
R5014:Col18a1	UTSW	10	77070960	critical splice donor site	probably null
R5107:Col18a1	UTSW	10	77077223	critical splice acceptor site	probably null
R5413:Col18a1	UTSW	10	77069476	missense	probably damaging	1.00
R5524:Col18a1	UTSW	10	77058724	missense	probably damaging	1.00
R5772:Col18a1	UTSW	10	77166343	missense	unknown
R5958:Col18a1	UTSW	10	77096397	missense	probably benign	0.01
R6280:Col18a1	UTSW	10	77112489	intron	probably benign
R6309:Col18a1	UTSW	10	77112742	intron	probably benign
R6603:Col18a1	UTSW	10	77063977	critical splice donor site	probably null
R6608:Col18a1	UTSW	10	77112794	intron	probably benign
R6805:Col18a1	UTSW	10	77054239	missense	probably damaging	1.00
R6890:Col18a1	UTSW	10	77113484	intron	probably benign
R6938:Col18a1	UTSW	10	77112499	intron	probably benign
R7002:Col18a1	UTSW	10	77166343	missense	unknown
R7154:Col18a1	UTSW	10	77072965	missense	probably benign	0.25
R7204:Col18a1	UTSW	10	77085276	missense	unknown
R7278:Col18a1	UTSW	10	77096284	missense	unknown
R7442:Col18a1	UTSW	10	77096238	missense	unknown
R7453:Col18a1	UTSW	10	77085210	splice site	probably null
R7597:Col18a1	UTSW	10	77113303	missense	unknown
R7615:Col18a1	UTSW	10	77067005	missense	probably damaging	1.00
R7671:Col18a1	UTSW	10	77085383	missense	unknown
R7696:Col18a1	UTSW	10	77085272	missense	unknown
R7719:Col18a1	UTSW	10	77078012	missense	probably benign	0.13
R7772:Col18a1	UTSW	10	77068386	splice site	probably null
R8077:Col18a1	UTSW	10	77080851	missense	unknown
R8085:Col18a1	UTSW	10	77088907	missense	unknown
R8097:Col18a1	UTSW	10	77112508	missense	unknown
R8117:Col18a1	UTSW	10	77059974	missense	probably benign	0.41
R8130:Col18a1	UTSW	10	77074450	missense	probably benign	0.03
R8151:Col18a1	UTSW	10	77112584	missense	unknown
R8379:Col18a1	UTSW	10	77053238	missense	probably benign	0.08
R8479:Col18a1	UTSW	10	77081154	missense	unknown
R8523:Col18a1	UTSW	10	77054234	missense	probably damaging	0.99
R8862:Col18a1	UTSW	10	77113210	nonsense	probably null
R9109:Col18a1	UTSW	10	77057370	missense	probably damaging	1.00
R9298:Col18a1	UTSW	10	77057370	missense	probably damaging	1.00
R9312:Col18a1	UTSW	10	77058772	missense	probably damaging	0.98
R9366:Col18a1	UTSW	10	77096424	missense	unknown
R9399:Col18a1	UTSW	10	77080750	missense	unknown
Z1176:Col18a1	UTSW	10	77055709	missense	possibly damaging	0.81
Z1176:Col18a1	UTSW	10	77112851	missense	unknown
Z1177:Col18a1	UTSW	10	77112838	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GAGTCTGGCTTCCAATGCAG -3'
(R):5'- CTAACCAGGGCTTGAACCAG -3'

Sequencing Primer
(F):5'- TCCTAGAGCCTTGGAGACTAG -3'
(R):5'- CCAGAAGAAACCTAGGTGATGGTC -3'

Posted On

2016-10-05