Incidental Mutation 'R5503:Col18a1'
ID430746
Institutional Source Beutler Lab
Gene Symbol Col18a1
Ensembl Gene ENSMUSG00000001435
Gene Namecollagen, type XVIII, alpha 1
Synonymsendostatin
MMRRC Submission 043064-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5503 (G1)
Quality Score214
Status Validated
Chromosome10
Chromosomal Location77052178-77166548 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 77071620 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 861 (G861D)
Ref Sequence ENSEMBL: ENSMUSP00000101049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072755] [ENSMUST00000081654] [ENSMUST00000105409]
Predicted Effect probably damaging
Transcript: ENSMUST00000072755
AA Change: G1108D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072538
Gene: ENSMUSG00000001435
AA Change: G1108D

DomainStartEndE-ValueType
Pfam:DUF959 16 218 6.8e-104 PFAM
low complexity region 295 307 N/A INTRINSIC
FRI 369 484 4.03e-47 SMART
TSPN 492 680 4.25e-72 SMART
LamG 541 679 2.17e-2 SMART
low complexity region 699 715 N/A INTRINSIC
low complexity region 719 734 N/A INTRINSIC
low complexity region 739 751 N/A INTRINSIC
Pfam:Collagen 820 881 5.5e-11 PFAM
low complexity region 921 942 N/A INTRINSIC
Pfam:Collagen 951 1008 6.1e-10 PFAM
Pfam:Collagen 988 1053 1.4e-8 PFAM
Pfam:Collagen 1060 1117 7.3e-10 PFAM
low complexity region 1132 1147 N/A INTRINSIC
low complexity region 1166 1181 N/A INTRINSIC
low complexity region 1186 1202 N/A INTRINSIC
Pfam:Collagen 1207 1267 8.2e-10 PFAM
low complexity region 1275 1288 N/A INTRINSIC
low complexity region 1301 1319 N/A INTRINSIC
low complexity region 1358 1393 N/A INTRINSIC
low complexity region 1397 1414 N/A INTRINSIC
low complexity region 1417 1433 N/A INTRINSIC
low complexity region 1441 1454 N/A INTRINSIC
Pfam:Endostatin 1461 1769 4.4e-116 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000081654
AA Change: G649D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080358
Gene: ENSMUSG00000001435
AA Change: G649D

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
TSPN 33 221 4.25e-72 SMART
LamG 82 220 2.17e-2 SMART
low complexity region 240 256 N/A INTRINSIC
low complexity region 260 275 N/A INTRINSIC
low complexity region 280 292 N/A INTRINSIC
Pfam:Collagen 359 422 1.6e-10 PFAM
low complexity region 462 483 N/A INTRINSIC
Pfam:Collagen 492 549 1.6e-9 PFAM
Pfam:Collagen 529 594 3.3e-8 PFAM
Pfam:Collagen 601 658 1.9e-9 PFAM
Pfam:Collagen 631 689 4e-8 PFAM
Pfam:Collagen 701 752 1.7e-7 PFAM
Pfam:Collagen 748 808 2.2e-9 PFAM
low complexity region 816 829 N/A INTRINSIC
low complexity region 842 860 N/A INTRINSIC
low complexity region 899 934 N/A INTRINSIC
low complexity region 938 955 N/A INTRINSIC
low complexity region 958 974 N/A INTRINSIC
low complexity region 982 995 N/A INTRINSIC
Pfam:Endostatin 999 1315 8.2e-151 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105409
AA Change: G861D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101049
Gene: ENSMUSG00000001435
AA Change: G861D

DomainStartEndE-ValueType
Pfam:DUF959 16 219 3.6e-100 PFAM
TSPN 245 433 4.25e-72 SMART
LamG 294 432 2.17e-2 SMART
low complexity region 452 468 N/A INTRINSIC
low complexity region 472 487 N/A INTRINSIC
low complexity region 492 504 N/A INTRINSIC
low complexity region 542 613 N/A INTRINSIC
low complexity region 630 648 N/A INTRINSIC
low complexity region 674 695 N/A INTRINSIC
Pfam:Collagen 700 761 5.4e-9 PFAM
Pfam:Collagen 741 806 4e-8 PFAM
Pfam:Collagen 813 874 2.1e-10 PFAM
Pfam:Collagen 846 901 1.2e-7 PFAM
Pfam:Collagen 913 964 2.1e-7 PFAM
Pfam:Collagen 960 1020 2.6e-9 PFAM
low complexity region 1028 1041 N/A INTRINSIC
low complexity region 1054 1072 N/A INTRINSIC
low complexity region 1111 1146 N/A INTRINSIC
low complexity region 1150 1167 N/A INTRINSIC
low complexity region 1170 1186 N/A INTRINSIC
low complexity region 1194 1207 N/A INTRINSIC
Pfam:Endostatin 1211 1527 1.1e-150 PFAM
Meta Mutation Damage Score 0.9603 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.5%
Validation Efficiency 96% (103/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XVIII collagen. This collagen is one of the multiplexins, extracellular matrix proteins that contain multiple triple-helix domains (collagenous domains) interrupted by non-collagenous domains. A long isoform of the protein has an N-terminal domain that is homologous to the extracellular part of frizzled receptors. Proteolytic processing at several endogenous cleavage sites in the C-terminal domain results in production of endostatin, a potent antiangiogenic protein that is able to inhibit angiogenesis and tumor growth. Mutations in this gene are associated with Knobloch syndrome. The main features of this syndrome involve retinal abnormalities, so type XVIII collagen may play an important role in retinal structure and in neural tube closure. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in hyaloid vessel regression, attenuated visual function, abnormal electroretinograms, broad proximal tubule basement membrane, podocyte effacement, and softened glomeruli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca6 A G 11: 110,218,257 S696P probably damaging Het
Abca9 G A 11: 110,141,610 T727M probably damaging Het
Alpk2 T C 18: 65,306,241 R1161G probably benign Het
Amy1 T C 3: 113,556,060 D487G probably benign Het
Arap2 G A 5: 62,630,186 A1409V probably damaging Het
B020004J07Rik A T 4: 101,835,802 Y334N probably benign Het
B4galt6 C A 18: 20,745,352 probably null Het
Cacna1s G A 1: 136,086,742 G382D probably damaging Het
Camk2a A G 18: 60,978,000 D87G probably damaging Het
Cdh18 A G 15: 23,436,534 Y492C probably damaging Het
Col4a3bp C T 13: 96,543,239 R26C possibly damaging Het
Crybg1 C A 10: 43,998,766 S782I probably benign Het
Csgalnact1 G A 8: 68,461,473 L27F probably damaging Het
Dab1 T A 4: 104,512,264 C3S probably benign Het
Dapk1 T C 13: 60,725,312 F343L probably benign Het
Dgat1 A T 15: 76,502,194 probably benign Het
Dnah11 C A 12: 117,880,451 probably null Het
Dsg2 T A 18: 20,580,651 Y226* probably null Het
Epg5 T A 18: 77,951,207 M351K possibly damaging Het
F13b A G 1: 139,522,543 T648A probably benign Het
Fgf17 T C 14: 70,636,968 Y127C probably damaging Het
Fkbp15 G A 4: 62,327,887 P435S probably benign Het
Gfm1 G A 3: 67,453,727 probably null Het
Gigyf1 T C 5: 137,523,467 probably benign Het
Gm12830 A T 4: 114,821,739 T6S unknown Het
Gm6465 A T 5: 11,848,183 N88I probably damaging Het
Gpr18 C T 14: 121,911,747 V289I probably damaging Het
Ipp G T 4: 116,537,938 E557* probably null Het
Klhl12 T A 1: 134,485,915 probably null Het
Klhl38 A G 15: 58,322,349 V328A possibly damaging Het
Kndc1 A G 7: 139,931,889 T1470A probably damaging Het
Kntc1 T A 5: 123,819,876 D2173E possibly damaging Het
Lipi T C 16: 75,573,976 K118E probably benign Het
Marf1 A C 16: 14,152,231 L208R probably damaging Het
Misp G A 10: 79,826,718 R323K probably damaging Het
Mlxip T A 5: 123,395,327 M133K probably damaging Het
Mon2 A T 10: 123,032,645 M501K possibly damaging Het
Myh2 A G 11: 67,173,449 I77V probably benign Het
Napa C A 7: 16,115,624 Q254K probably benign Het
Nckap5l C A 15: 99,425,622 G1000V probably damaging Het
Neo1 A T 9: 58,985,650 S236R possibly damaging Het
Neurl4 T A 11: 69,906,368 Y594N probably damaging Het
Nmral1 G A 16: 4,715,629 P94L probably benign Het
Notch3 A T 17: 32,147,055 I1024N probably benign Het
Nsd1 T A 13: 55,245,939 I451K probably damaging Het
Nt5c3b T C 11: 100,433,057 D143G probably benign Het
Olfr1415 C A 1: 92,491,196 K186N probably benign Het
Olfr27 A G 9: 39,144,484 N128S probably benign Het
Olfr316 T A 11: 58,758,328 V221E probably damaging Het
Olfr45 A C 7: 140,691,396 M164L probably benign Het
Olfr77 A G 9: 19,920,379 T57A probably benign Het
Olfr912 T C 9: 38,582,072 V265A probably benign Het
Oplah A G 15: 76,305,446 probably null Het
Phb2 T A 6: 124,713,022 probably benign Het
Plcl2 A G 17: 50,509,929 I108V probably benign Het
Plpp6 T A 19: 28,964,746 M249K probably damaging Het
Pnpt1 G A 11: 29,138,156 G189E probably damaging Het
Ptprn C T 1: 75,251,875 V853M probably damaging Het
Ptprq T C 10: 107,688,328 probably null Het
Rai1 G A 11: 60,186,453 V448I probably benign Het
Rbm20 T A 19: 53,851,354 C925S possibly damaging Het
Rin3 C A 12: 102,313,055 P41Q probably benign Het
Rpl31-ps21 T C 5: 21,119,507 noncoding transcript Het
Rpl39-ps A T 15: 102,635,126 noncoding transcript Het
Rtn4ip1 T A 10: 43,907,883 D133E probably benign Het
Ryr1 T C 7: 29,069,028 K2839E possibly damaging Het
Sept5 T C 16: 18,623,368 K268R probably benign Het
Serpinb6b T A 13: 32,977,659 D238E possibly damaging Het
Slc15a2 C T 16: 36,762,385 V214M probably damaging Het
Smarca2 T C 19: 26,623,936 M18T probably damaging Het
Smarca2 C A 19: 26,682,046 T912K possibly damaging Het
Smdt1 A T 15: 82,347,900 R46S possibly damaging Het
Spa17 A C 9: 37,611,977 F5V probably damaging Het
Spag17 A G 3: 100,027,244 E614G possibly damaging Het
Sstr4 CGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 2: 148,395,551 probably benign Het
Tlr1 A T 5: 64,926,292 V314D probably damaging Het
Trappc8 A T 18: 20,836,900 L1011Q probably benign Het
Tsga10 A G 1: 37,760,947 *691Q probably null Het
Vav1 A T 17: 57,303,079 K420* probably null Het
Vmn1r174 C G 7: 23,754,137 T76R probably benign Het
Vmn2r116 A G 17: 23,386,804 E230G probably benign Het
Vps13b A G 15: 35,452,166 T637A probably damaging Het
Zbtb7a A G 10: 81,144,797 E275G probably damaging Het
Zfp280b A G 10: 76,039,462 probably null Het
Zfp763 A G 17: 33,019,533 Y213H possibly damaging Het
Zfp78 T A 7: 6,378,529 W161R probably benign Het
Other mutations in Col18a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Col18a1 APN 10 77069979 missense possibly damaging 0.93
IGL01023:Col18a1 APN 10 77070975 missense probably damaging 0.98
IGL01304:Col18a1 APN 10 77076141 unclassified probably benign
IGL01519:Col18a1 APN 10 77059323 missense probably damaging 0.99
IGL02217:Col18a1 APN 10 77053298 missense probably damaging 0.96
IGL02275:Col18a1 APN 10 77059383 missense possibly damaging 0.92
IGL02283:Col18a1 APN 10 77113109 missense possibly damaging 0.71
IGL02492:Col18a1 APN 10 77072021 splice site probably benign
IGL02673:Col18a1 APN 10 77059163 missense probably damaging 1.00
IGL02710:Col18a1 APN 10 77113312 missense possibly damaging 0.92
IGL02850:Col18a1 APN 10 77096466 missense probably damaging 0.98
IGL03085:Col18a1 APN 10 77059181 splice site probably benign
IGL03102:Col18a1 APN 10 77067623 splice site probably benign
IGL03139:Col18a1 APN 10 77113343 missense possibly damaging 0.84
IGL03181:Col18a1 APN 10 77055698 missense probably damaging 1.00
IGL03183:Col18a1 APN 10 77073754 missense probably damaging 1.00
R0039:Col18a1 UTSW 10 77077168 missense probably damaging 1.00
R0180:Col18a1 UTSW 10 77096517 missense probably benign 0.33
R0225:Col18a1 UTSW 10 77088914 missense possibly damaging 0.90
R0335:Col18a1 UTSW 10 77059363 missense probably damaging 0.99
R0336:Col18a1 UTSW 10 77058736 missense probably damaging 1.00
R1471:Col18a1 UTSW 10 77096206 missense unknown
R1538:Col18a1 UTSW 10 77071336 missense probably damaging 1.00
R1594:Col18a1 UTSW 10 77113036 missense possibly damaging 0.51
R1631:Col18a1 UTSW 10 77059297 missense probably damaging 0.99
R1774:Col18a1 UTSW 10 77059981 missense probably damaging 0.96
R1934:Col18a1 UTSW 10 77112744 missense possibly damaging 0.73
R1990:Col18a1 UTSW 10 77081154 missense unknown
R1991:Col18a1 UTSW 10 77081154 missense unknown
R1992:Col18a1 UTSW 10 77081154 missense unknown
R2081:Col18a1 UTSW 10 77054185 missense probably damaging 1.00
R2082:Col18a1 UTSW 10 77059293 missense probably damaging 1.00
R2351:Col18a1 UTSW 10 77112704 missense probably benign 0.00
R2510:Col18a1 UTSW 10 77096268 missense unknown
R3076:Col18a1 UTSW 10 77088928 missense possibly damaging 0.57
R3433:Col18a1 UTSW 10 77096268 missense unknown
R3800:Col18a1 UTSW 10 77067387 nonsense probably null
R3918:Col18a1 UTSW 10 77053358 missense probably benign 0.05
R3981:Col18a1 UTSW 10 77088887 missense probably damaging 0.99
R3983:Col18a1 UTSW 10 77088887 missense probably damaging 0.99
R4182:Col18a1 UTSW 10 77058841 splice site probably null
R4239:Col18a1 UTSW 10 77096167 missense unknown
R5014:Col18a1 UTSW 10 77070960 critical splice donor site probably null
R5107:Col18a1 UTSW 10 77077223 critical splice acceptor site probably null
R5413:Col18a1 UTSW 10 77069476 missense probably damaging 1.00
R5524:Col18a1 UTSW 10 77058724 missense probably damaging 1.00
R5772:Col18a1 UTSW 10 77166343 missense unknown
R5958:Col18a1 UTSW 10 77096397 missense probably benign 0.01
R6280:Col18a1 UTSW 10 77112489 intron probably benign
R6309:Col18a1 UTSW 10 77112742 intron probably benign
R6603:Col18a1 UTSW 10 77063977 critical splice donor site probably null
R6608:Col18a1 UTSW 10 77112794 intron probably benign
R6805:Col18a1 UTSW 10 77054239 missense probably damaging 1.00
R6890:Col18a1 UTSW 10 77113484 intron probably benign
R6938:Col18a1 UTSW 10 77112499 intron probably benign
R7002:Col18a1 UTSW 10 77166343 missense unknown
R7154:Col18a1 UTSW 10 77072965 missense probably benign 0.25
R7204:Col18a1 UTSW 10 77085276 missense unknown
R7278:Col18a1 UTSW 10 77096284 missense unknown
R7442:Col18a1 UTSW 10 77096238 missense unknown
R7453:Col18a1 UTSW 10 77085210 intron probably null
R7597:Col18a1 UTSW 10 77113303 missense unknown
R7615:Col18a1 UTSW 10 77067005 missense probably damaging 1.00
R7671:Col18a1 UTSW 10 77085383 missense unknown
R7696:Col18a1 UTSW 10 77085272 missense unknown
R7719:Col18a1 UTSW 10 77078012 missense probably benign 0.13
Z1176:Col18a1 UTSW 10 77055709 missense possibly damaging 0.81
Z1176:Col18a1 UTSW 10 77112851 missense unknown
Z1177:Col18a1 UTSW 10 77112838 missense unknown
Predicted Primers PCR Primer
(F):5'- GAGTCTGGCTTCCAATGCAG -3'
(R):5'- CTAACCAGGGCTTGAACCAG -3'

Sequencing Primer
(F):5'- TCCTAGAGCCTTGGAGACTAG -3'
(R):5'- CCAGAAGAAACCTAGGTGATGGTC -3'
Posted On2016-10-05