Incidental Mutation 'R5495:Nr4a2'
ID432270
Institutional Source Beutler Lab
Gene Symbol Nr4a2
Ensembl Gene ENSMUSG00000026826
Gene Namenuclear receptor subfamily 4, group A, member 2
SynonymsRNR-1, HZF-3, Nurr1
MMRRC Submission 043056-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5495 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location57106830-57124003 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57112375 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 22 (Y22C)
Ref Sequence ENSEMBL: ENSMUSP00000108248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028166] [ENSMUST00000112627] [ENSMUST00000112629] [ENSMUST00000183542]
Predicted Effect probably damaging
Transcript: ENSMUST00000028166
AA Change: Y22C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028166
Gene: ENSMUSG00000026826
AA Change: Y22C

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 124 134 N/A INTRINSIC
ZnF_C4 260 331 2.45e-39 SMART
low complexity region 346 363 N/A INTRINSIC
HOLI 408 566 1.03e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112627
SMART Domains Protein: ENSMUSP00000108246
Gene: ENSMUSG00000026826

DomainStartEndE-ValueType
low complexity region 61 71 N/A INTRINSIC
ZnF_C4 197 268 2.45e-39 SMART
low complexity region 283 300 N/A INTRINSIC
HOLI 345 503 1.03e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112629
AA Change: Y22C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108248
Gene: ENSMUSG00000026826
AA Change: Y22C

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 124 134 N/A INTRINSIC
ZnF_C4 260 331 2.45e-39 SMART
low complexity region 346 363 N/A INTRINSIC
HOLI 408 566 1.03e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140165
Predicted Effect probably benign
Transcript: ENSMUST00000183542
SMART Domains Protein: ENSMUSP00000138824
Gene: ENSMUSG00000026826

DomainStartEndE-ValueType
low complexity region 61 71 N/A INTRINSIC
ZnF_C4 197 268 2.45e-39 SMART
low complexity region 283 300 N/A INTRINSIC
Pfam:Hormone_recep 322 392 9.1e-8 PFAM
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the steroid-thyroid hormone-retinoid receptor superfamily. The encoded protein may act as a transcription factor. Mutations in this gene have been associated with disorders related to dopaminergic dysfunction, including Parkinson disease, schizophernia, and manic depression. Misregulation of this gene may be associated with rheumatoid arthritis. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene fail to develop dopaminergic neurons in the mesencephalon and die within the first 12 hours of life. Heterozygotes suffer from reduced motor performance in old age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik A T 3: 91,090,295 L38M possibly damaging Het
Akt2 T C 7: 27,636,169 probably null Het
Arhgap29 T G 3: 122,014,929 M844R probably damaging Het
Atp1a1 T G 3: 101,591,425 D184A probably benign Het
Bcl11a T A 11: 24,165,042 V795E possibly damaging Het
Casp12 T A 9: 5,353,797 I277N possibly damaging Het
Ccdc59 A G 10: 105,845,378 K164E probably damaging Het
D630003M21Rik C T 2: 158,220,511 G30S possibly damaging Het
Dgkd A G 1: 87,926,872 D632G probably damaging Het
Efr3a A G 15: 65,815,409 K56E possibly damaging Het
Egflam T A 15: 7,251,241 R434S probably damaging Het
Fancl C G 11: 26,397,801 A51G probably damaging Het
Fkbp7 T C 2: 76,663,294 Y185C probably damaging Het
Galc A G 12: 98,231,414 probably null Het
Galnt15 A G 14: 32,029,817 S109G probably damaging Het
Gm13757 T C 2: 88,446,057 T294A probably benign Het
Gramd3 T C 18: 56,482,622 I163T probably damaging Het
Impa1 A G 3: 10,326,170 V80A probably benign Het
Itga10 T C 3: 96,647,371 M56T possibly damaging Het
Larp1b G T 3: 41,035,822 R135I probably damaging Het
Lgals12 C T 19: 7,604,130 A71T probably damaging Het
Lmbr1 A T 5: 29,346,853 L78* probably null Het
Lrat C A 3: 82,896,982 M229I probably benign Het
Mug2 A T 6: 122,079,650 M1185L probably damaging Het
Naprt T C 15: 75,893,847 probably null Het
Nfat5 A G 8: 107,368,447 I1107V probably benign Het
Ogfod1 C A 8: 94,064,278 Q526K probably benign Het
Olfr139 G A 11: 74,044,785 T163I probably damaging Het
Olfr710 C A 7: 106,944,492 G170* probably null Het
Olfr957 T C 9: 39,511,145 T192A probably benign Het
Parp10 T G 15: 76,243,166 I24L probably benign Het
Pcdha11 A G 18: 37,011,026 T57A probably benign Het
Prdm8 A G 5: 98,185,306 E244G possibly damaging Het
Prl6a1 T C 13: 27,312,671 S3P possibly damaging Het
Rab11fip3 T A 17: 26,016,143 T18S probably damaging Het
Rfc4 T C 16: 23,122,254 probably benign Het
Rubcnl G T 14: 75,042,337 V387F possibly damaging Het
Serpinb12 T C 1: 106,956,421 L299P probably damaging Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Taar4 A T 10: 23,961,283 I264F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Thsd7b T A 1: 129,595,833 H124Q probably damaging Het
Ugt1a6a A T 1: 88,139,024 Q184L probably benign Het
Vnn1 T A 10: 23,898,564 F168L probably damaging Het
Zan A G 5: 137,470,408 L267P probably damaging Het
Zswim8 A G 14: 20,722,286 S1621G probably damaging Het
Other mutations in Nr4a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Nr4a2 APN 2 57109217 missense probably damaging 1.00
IGL01148:Nr4a2 APN 2 57111971 missense probably benign 0.00
IGL01395:Nr4a2 APN 2 57112153 missense probably damaging 0.98
IGL02123:Nr4a2 APN 2 57111655 missense possibly damaging 0.95
IGL02311:Nr4a2 APN 2 57111731 missense probably benign
IGL02698:Nr4a2 APN 2 57108160 missense probably damaging 1.00
IGL03178:Nr4a2 APN 2 57110766 missense probably damaging 1.00
IGL03261:Nr4a2 APN 2 57110187 missense probably benign 0.40
R0025:Nr4a2 UTSW 2 57108615 missense probably benign 0.14
R0078:Nr4a2 UTSW 2 57112228 missense probably damaging 1.00
R1138:Nr4a2 UTSW 2 57112379 missense probably damaging 0.96
R1222:Nr4a2 UTSW 2 57108324 missense probably damaging 0.97
R1418:Nr4a2 UTSW 2 57108324 missense probably damaging 0.97
R1755:Nr4a2 UTSW 2 57109092 missense probably damaging 1.00
R2265:Nr4a2 UTSW 2 57112006 missense possibly damaging 0.77
R2266:Nr4a2 UTSW 2 57112006 missense possibly damaging 0.77
R2267:Nr4a2 UTSW 2 57112006 missense possibly damaging 0.77
R2281:Nr4a2 UTSW 2 57112199 missense probably benign 0.00
R4191:Nr4a2 UTSW 2 57112379 missense probably damaging 0.96
R4706:Nr4a2 UTSW 2 57112213 missense probably damaging 1.00
R4707:Nr4a2 UTSW 2 57112093 missense probably benign 0.17
R4745:Nr4a2 UTSW 2 57110151 missense probably damaging 1.00
R4924:Nr4a2 UTSW 2 57112023 missense probably benign 0.00
R5350:Nr4a2 UTSW 2 57111865 missense probably damaging 0.98
R6139:Nr4a2 UTSW 2 57108689 missense probably damaging 0.98
R6156:Nr4a2 UTSW 2 57112352 missense probably damaging 1.00
R6325:Nr4a2 UTSW 2 57112418 missense probably damaging 1.00
R6674:Nr4a2 UTSW 2 57112424 missense probably damaging 1.00
R6786:Nr4a2 UTSW 2 57111908 missense probably benign 0.29
R6968:Nr4a2 UTSW 2 57108746 splice site probably null
R7135:Nr4a2 UTSW 2 57112249 missense possibly damaging 0.80
R7256:Nr4a2 UTSW 2 57112369 missense probably damaging 1.00
R7495:Nr4a2 UTSW 2 57112159 missense possibly damaging 0.89
R7596:Nr4a2 UTSW 2 57108231 missense probably damaging 1.00
R7733:Nr4a2 UTSW 2 57112321 missense probably benign 0.01
R7812:Nr4a2 UTSW 2 57112418 missense probably damaging 1.00
Z1088:Nr4a2 UTSW 2 57111614 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTAATGGAGGACTGCTGTC -3'
(R):5'- GACCCTCAACAGCTTTCCAG -3'

Sequencing Primer
(F):5'- CGGACAGGGGCATTTGGTAC -3'
(R):5'- TCGTCCCGGGATCAGCC -3'
Posted On2016-10-05