Incidental Mutation 'R5495:Prdm8'
ID432284
Institutional Source Beutler Lab
Gene Symbol Prdm8
Ensembl Gene ENSMUSG00000035456
Gene NamePR domain containing 8
Synonyms
MMRRC Submission 043056-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.586) question?
Stock #R5495 (G1)
Quality Score206
Status Not validated
Chromosome5
Chromosomal Location98167198-98188991 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98185306 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 244 (E244G)
Ref Sequence ENSEMBL: ENSMUSP00000147333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112959] [ENSMUST00000210477]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000057889
Predicted Effect possibly damaging
Transcript: ENSMUST00000112959
AA Change: E244G

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108583
Gene: ENSMUSG00000035456
AA Change: E244G

DomainStartEndE-ValueType
SET 20 137 1.55e0 SMART
ZnF_C2H2 154 182 2.37e2 SMART
low complexity region 192 219 N/A INTRINSIC
low complexity region 275 291 N/A INTRINSIC
low complexity region 315 332 N/A INTRINSIC
low complexity region 397 427 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
low complexity region 556 570 N/A INTRINSIC
low complexity region 599 621 N/A INTRINSIC
ZnF_C2H2 624 646 9.22e0 SMART
ZnF_C2H2 665 687 1.2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205851
Predicted Effect possibly damaging
Transcript: ENSMUST00000210477
AA Change: E244G

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a conserved family of histone methyltransferases that predominantly act as negative regulators of transcription. The encoded protein contains an N-terminal Su(var)3-9, Enhancer-of-zeste, and Trithorax (SET) domain and a double zinc-finger domain. Knockout of this gene in mouse results in mistargeting by neurons of the dorsal telencephalon, abnormal itch-like behavior, and impaired differentiation of rod bipolar cells. In humans, the protein has been shown to interact with the phosphatase laforin and the ubiquitin ligase malin, which regulate glycogen construction in the cytoplasm. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature termination of corticopsinal motor neuron axons, absent corpus callosum and hippocampal commissure, excessive scratching, skin lesions, and contraction of hindpaws resulting a handstand phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik A T 3: 91,090,295 L38M possibly damaging Het
Akt2 T C 7: 27,636,169 probably null Het
Arhgap29 T G 3: 122,014,929 M844R probably damaging Het
Atp1a1 T G 3: 101,591,425 D184A probably benign Het
Bcl11a T A 11: 24,165,042 V795E possibly damaging Het
Casp12 T A 9: 5,353,797 I277N possibly damaging Het
Ccdc59 A G 10: 105,845,378 K164E probably damaging Het
D630003M21Rik C T 2: 158,220,511 G30S possibly damaging Het
Dgkd A G 1: 87,926,872 D632G probably damaging Het
Efr3a A G 15: 65,815,409 K56E possibly damaging Het
Egflam T A 15: 7,251,241 R434S probably damaging Het
Fancl C G 11: 26,397,801 A51G probably damaging Het
Fkbp7 T C 2: 76,663,294 Y185C probably damaging Het
Galc A G 12: 98,231,414 probably null Het
Galnt15 A G 14: 32,029,817 S109G probably damaging Het
Gm13757 T C 2: 88,446,057 T294A probably benign Het
Gramd3 T C 18: 56,482,622 I163T probably damaging Het
Impa1 A G 3: 10,326,170 V80A probably benign Het
Itga10 T C 3: 96,647,371 M56T possibly damaging Het
Larp1b G T 3: 41,035,822 R135I probably damaging Het
Lgals12 C T 19: 7,604,130 A71T probably damaging Het
Lmbr1 A T 5: 29,346,853 L78* probably null Het
Lrat C A 3: 82,896,982 M229I probably benign Het
Mug2 A T 6: 122,079,650 M1185L probably damaging Het
Naprt T C 15: 75,893,847 probably null Het
Nfat5 A G 8: 107,368,447 I1107V probably benign Het
Nr4a2 T C 2: 57,112,375 Y22C probably damaging Het
Ogfod1 C A 8: 94,064,278 Q526K probably benign Het
Olfr139 G A 11: 74,044,785 T163I probably damaging Het
Olfr710 C A 7: 106,944,492 G170* probably null Het
Olfr957 T C 9: 39,511,145 T192A probably benign Het
Parp10 T G 15: 76,243,166 I24L probably benign Het
Pcdha11 A G 18: 37,011,026 T57A probably benign Het
Prl6a1 T C 13: 27,312,671 S3P possibly damaging Het
Rab11fip3 T A 17: 26,016,143 T18S probably damaging Het
Rfc4 T C 16: 23,122,254 probably benign Het
Rubcnl G T 14: 75,042,337 V387F possibly damaging Het
Serpinb12 T C 1: 106,956,421 L299P probably damaging Het
Sptbn5 G A 2: 120,046,484 probably benign Het
Taar4 A T 10: 23,961,283 I264F possibly damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Thsd7b T A 1: 129,595,833 H124Q probably damaging Het
Ugt1a6a A T 1: 88,139,024 Q184L probably benign Het
Vnn1 T A 10: 23,898,564 F168L probably damaging Het
Zan A G 5: 137,470,408 L267P probably damaging Het
Zswim8 A G 14: 20,722,286 S1621G probably damaging Het
Other mutations in Prdm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Prdm8 APN 5 98183343 missense probably damaging 1.00
IGL02208:Prdm8 APN 5 98183465 missense possibly damaging 0.93
IGL02676:Prdm8 APN 5 98186559 missense probably damaging 1.00
R0060:Prdm8 UTSW 5 98185260 missense probably benign 0.19
R0063:Prdm8 UTSW 5 98184594 missense probably damaging 0.98
R0063:Prdm8 UTSW 5 98184594 missense probably damaging 0.98
R0630:Prdm8 UTSW 5 98184521 missense probably damaging 1.00
R1099:Prdm8 UTSW 5 98183502 missense probably damaging 0.99
R4373:Prdm8 UTSW 5 98186508 missense probably damaging 1.00
R4643:Prdm8 UTSW 5 98184587 missense possibly damaging 0.61
R4936:Prdm8 UTSW 5 98185022 critical splice acceptor site probably null
R4936:Prdm8 UTSW 5 98185023 critical splice acceptor site probably null
R5033:Prdm8 UTSW 5 98185212 nonsense probably null
R6307:Prdm8 UTSW 5 98185303 missense possibly damaging 0.84
R6562:Prdm8 UTSW 5 98183343 missense possibly damaging 0.82
R6970:Prdm8 UTSW 5 98184612 missense probably damaging 0.99
R7343:Prdm8 UTSW 5 98184516 missense probably damaging 1.00
Z1177:Prdm8 UTSW 5 98184632 missense probably damaging 1.00
Z1177:Prdm8 UTSW 5 98186551 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGATGCGAATCCCCAAGACG -3'
(R):5'- TTCTTCACCTCCACGAAGGC -3'

Sequencing Primer
(F):5'- TCCCCAAGACGAGCAAGGG -3'
(R):5'- TTCTCCTCCAGGCCGAAGTAG -3'
Posted On2016-10-05